Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33215  (registered. 2012)
Contig Information
Length 1008 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_VHS Shoot with heat shock treatment 1
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125563034|gb|EAZ08414.1|| hypothetical protein OsI_30678 [Oryza sativa Indica Group]
Score 363
Evalue 1.00E-98
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33215
GAATGGCAGTTCTTGGTCTATCTACTGCCTTCTCTCCCCCCAGAGGTTCTTGGATAGCCGTAAGGCTCAGGCATGGCGCCACCGGGCGGAGCAGCGGCGG
CCTGTCCCTGAGGAGGTCCGCCGCCGCCGCCGTGGCCGTCCGCGCGGAGGTGAGCTTCGTGGACGGCGACGAGGCGAAGCGGCTGGTGGCGGAGGAGGGG
TACACGGTGCTGGACGTCCGGGACCGGCGGCAGTACGAGAGGGCGCACGTCAGGGCCTCCGCCCACGTCCCGCTCTACATCGAGAACGAAGACAACGACA
TTGGAACGATCATCAAGCGGCAGGCGCACAACAACTTCGCCGGCCTGTTCTACGGCCTGTCCTTCACCAAGCTCAACCGGGACTTCACCAAGACGGTGAG
GAGCAAGTTCTCGCCGGAGAGCAAGCTGCTGGTTGTCTGCCAGGAAGGCCTCAGGTCCACAGCGGCTGCAGATGCATTGGAGCGAGAGGGCTTCCAGAAC
CTGGCCTGCATCACCTCAGGTCTTCAGACACTGAAACCAGGAACGTTTGAGACCATCGGCAAAGCCGAGCTGCAGAATGCGGGGAAAGCCGGCCTTGTGA
CCATCCAGGGGAAGATCTCCATAGTTCTTGGGACTATCTTGATAACCTTGTTGCTGCTCATAACAGTGTTCCCAGACCAGGCTGAGCAGATCTTCGAGTC
AGCTGGCATCAAATTGTGATAAGAATCGCCGCTCTTCTAGTTATGCTCTTGAGTTCATATGTTTCACTGTCAGCTGCAGGTTAAGCGTATCAGTAGGTGT
ACTTGGTGAGATCTCTTCAGACTGGAAAGGGATGTTAGGCTCCATGTGTCATATTTAGGGACTTTCTGAAAATTCTACTACTGTGTATTTTTGGCTCGAG
TAATTTCTTTTTTCCCACATACACCCTTTTCTGTGTCAATTGTAGTTCGATCCATAAATTTTGTGGCGTTTCAAGTAAAAAACAGATTATGTTCAACTAA
AAAAAAAA
page-top