Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33195  (registered. 2012)
Contig Information
Length 1164 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115456099|ref|NP_001051650.1|| Os03g0808300 [Oryza sativa (japonica cultivar-group)]
Score 350
Evalue 2.00E-94
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33195
ACGAGGAGGGCACTCTGGTGACCAGCACCACCAACACCACCTTCCACGACGTCGACGAGGTGATCGAGGTGCGCGAGGTCCACCCCCTGTCGCCGCCGCC
GCAGCACCCGCCCTTCACGCCGCCCACGCGCACCGTCTCCGCCGCCTCCACCGCCTGGGACAGCGCCAGCAGCCACCGCTCCGTCACCTCCGAGGAGCAG
TTCATGACGATGAGCCGCGAGTTCACGGCCATGGTCGCCGCCGGCGCCGGCGCCGGCGCGGCCAACAACGCCAACAGTAACAACAGCAACAGCAACCACC
CCGGCGGCCCCTACGACGGCGGCGCCGACCAGCTGACCAGCATCGGCGAGGACGAGCTGGAGGAGCACAACCCGCTGGCCATCGTGCCGGACAGCGGCCG
CCCCTTCGCCACGCCGCCCAGCAGGAGCGGCGGCGGCAGCGGCAGGGCGGCGCGGCTCGACCTGGAGGTGGTTCCCGCCGCCGGCCCGCCGGTGGAGGCG
AGCCAGGTGAAGAAGGAGGAGGTGGAGACCAAGGTGTCGGCGTGGCAGACGGCGGAGATCGCCAAGATCAACAACCGGTTCAAGAGGGAGGAGGTGGTCA
TCAACGGCTGGGAGACGGAGCAGGTCGACAAGGCCTCCGCCTGGCTCAAGAAGATTGAGAGGAAGCTGGACGAGCAGCGCGCCAAGGCGGTGGAGAAGAC
GCAGAACGACGTGGCCAAGGCGCGGCACAAGGCGGAGGAGAAGCGGGCGTCGGCGGAGGCCAAGCGGGGGCTCAAGCTGGCCAAGGTGCTGGAGCTGGCC
AACTTCATGAAGGCCGTCGGCAGGGTGCCCACCAAGCGCTCCTTCTTCTAGCCCGCCCGCCCGCCGGCCTCCCTCAACTCTGGAATCCTGTCTGTTTTTG
CCCATGGGTAGTAAAAAGTAAGGGCGTGTGCTGCTGCTGCTGCATCCGATCGGTCGGGAAACCTAATTGTAAAAAGGATTTGAAAACTTGCTGCTGCTGC
TGCCTCCGTTGTATACTAGCCGCCGGGGGCCATCACTGATCACACGGTGGCGCTTTTTTGTTTGGCTTGTATATGCACGAAAAACTGGTGTGGAAATGGA
ATGAATAGCGTGTTTGCCACAAACCTGCAAACATTCAGAGCAAAAAAAAAAATCAAAAAAAAAA
page-top