Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33145  (registered. 2012)
Contig Information
Length 930 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_r Root 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
WH_XE Seedling, infected with leaf rust 5
WH_XF Seedling, infected with leaf rust 7
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|62733593|gb|AAX95710.1|| Remorin, C-terminal region, putative [Oryza sativa Japonica Group]"
Score 253
Evalue 2.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33145
CTGTTATAGTGTTGTGTGCACGAAAAGACTACTCCATCTTTATACAGTATACACCCAAGTATCCCACAAAATAATCACAAATTACATCACGACGCAATTG
ATGATACCATACAAACTAAGATCACTCCCAGAGATAAATACACAAGTGATGCAATGGGCAGCACACATTGCAACGGTCAAACAGAGAGAAGCTGAAGATG
AAGCGAAGAGGACTGTCTCCAAGCCGCGGCTATCTATCCCCTGCCGAAGAGCAGCTTCTTCGGCGCCTCACCCTTGGCGCGGTACTTGGCGGCGGCCTCC
TCCGCCGCGACGATCTCCTCGCCGCGCCGCACTTCCGCCGCGGCACGCTTCTCCTCCGCCTCTTTGTGCACCGTCGCGGCGCTGTTCTTGAGCTTCTCCA
CGCAGCGCGCCTTCTTCTTCTCCAGCTGCTCTTGCATCTTCTTGAGCTCGGCTTCCAGTTCCGCGGCCTTGGAGTTCTCCCACGAGGTGATGTCCGCCAG
CAACTTCACGGCCTTGTTCTCGGCTTTGGCCTTCTCGTTCTCCTCCCATGCCTTGATCAGCGAAATCCTCTTCTCGGTCGCGACCCTCGTGAGCAGAGCA
TCTCGTTCGTGTGAGCCCCCTGTAGCTGCAGGCTTCTCGGCGTCATTCTCGGCGACAACCAGGGCCTTAGACTCCTCCGGCGACGGAACCGCCGCCTTCT
CGTCCGCGACGTCCTCGGTCGGCTCCGGCGCGGGTGGCGCCACATCCTGCTTCGCTTCCTCCGCCATCTGATCAACCTCGCAACGAGTCGATCAAGATAT
TTTAGCAAGACACGGAGTCAGAGGAGCCCAGAGTACAGTCTTGTTTGTGCTGGTCGGACGTGGTGGCTGGCAAACTAAAGCCAACGCAAGAGTACTATAT
GCAGCGGCCGCAGGAAGAGAGAGGGGAGAC
page-top