Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3314  (registered. 2012)
Contig Information
Length 1043 bp
Clones alternative view 75 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_V4816 Shoot grown under cold condition for 16days 9
Wh_V483 Shoot grown under cold condition for 3days 11
Wh_VABA Shoot with ABA treatment 15
Wh_VHS Shoot with heat shock treatment 7
Wh_VWD Shoot grown with dessication 7
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 7
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 5
WH_SP 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68566191|sp|Q7X9A6.1|UCRIA_WHEAT|UCRIA_WHEAT RecName: Full=Cytochrome b6-f complex iron-sulfur subunit,"
Score 459
Evalue 2.00E-127
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3314
TACATCGTAGTACCAGATCCCGAGTCCTCAAAATGTGATGCTATATGNNATGAAAAGGTTTCTCTTCTTCCATAGACTGTATACATATAACTGGATACAA
GAAACAGGTGCATTTATAGCAGGAGTAGTCTTATAGCAGCGTTCTTAGGACTGGCAGGAGGCTTAACATATCACACGAGTGAGCATTGCTGCCGGAGCTT
GCGTCGCTTATTTCCACCACGGGTTGTCGCCGGTCCTGAAGTCGGTCTCCACCCACGGCACGAAGACGACCTTGCCGTCGTCGACGTCGGCGTGAACAAG
GGCCAGCGACAGAGGTGCAGGCCCACGGACAACCTTGCCCTGGTTGTTGTACTGGGATCCATGGCAGGGGCAGAGGAACTTGTTCTCGGCGGCGTTCCAC
GGCACGACGCATCCAAGATGCGTGCACACGGCGTTGATCCCGTAGGTGGCGAGGGTCTTGTCGGACTCCACCACAAGGTAGGTAGGATCACCCTTGAGCC
CCTGGGCGAGCGTGCGGTCGTTGGGGCCGTGCGTCTTGAGCCAGTCCTCGACGAGGATGTCGTTGCCGAGCTTGTCCTTGGCGGCGACCCCTCCGGCGTT
GCTCCCGGAGCCGGCCGGGACGAGGAAGGAACCGTAGGGGACGAGCATGCCGAAGGTGGGGAGCGAGATGGCGCCCAGCAGGAGCAGGTTCATCAGCTCC
CTCTTGCTCATGTCCGGCACGCGGTCCGCGGAGATGCTGCCGGCCATGCAGGTGATGTTCCTCGGGACGCGCTCCCGGCTGAAGCCCAGGCCCTTGACGG
GCTTGCACAGCGAGCTTGCGCGGGTCCGGCAGAGCTGGGTAGGGTTGGAGGCGGTGGAGAGCGCGGTGGAGGCCATGGCGACTGGCTGCGTCACGGCGGA
GAGGACGATCGAGCGAGCGAGCGAGCTAGCACTGCATTGGTTACAAGCTTATGGCAAAGAGGGAGCTGAAGGATCCAGAGAATGCACTAATTGGCGCCTT
TGCCGGTGCGATTACTGGTGCTATAACAACCCCCCTCGATGTG
page-top