Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3307  (registered. 2012)
Contig Information
Length 756 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 1
Wh_yd Spikelet at late flowering 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115462083|ref|NP_001054641.1|| Os05g0147400 [Oryza sativa (japonica cultivar-group)]
Score 254
Evalue 9.00E-66
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3307
TGCAGAATATCTTTTCAGTTTGGGTGTTGAACCAATCCAGGTATACCTAAGATTGCGCCCCTACTAAAGGCAGGCTTTGCTCAACACAAACAAGAATCCA
ATCACCACCAGCACACAAAAAATACATAGCTGCTCAACTTGATCCAACACGAAAATATTCTGCATACAAACACCAGCGTAGAAACACATCGACAAACTGT
CACGAGGGTTGTTACAAGTACAATCTCTTGCACTCAAGCATTCCACCCCACCACATCACTACTCGCTACGTACTCGGCACCCCACAGAGAAAAACAGCCA
AACAAAAAGTCTTCTCGGCCTGGAAGGGGCGAGCGCTAGGTTTAGGTTGGTTTCCTCATGTTTCGCCCTGCCCTGATCACCTCATCCACTAGCAACAGCT
GCGACGCGATGATGGGTCCGGAATTGACGATCTGGCGCTTCACAGAGTAGTTGTCGTAGATGCCTTCCATCTCGGGGTCGACCGGCTCGCCAGTGTTATG
GTTCAGCCCCACCACCAGCCCACGGTCATGTTCATTCTCAAGAGAGACAATAACGTCTTGGGTGTCTAAGCCCGAATTCTCTGCTAGCGTCTTGGGGATA
ACGAGTAGAGCATCGGCAAATGCCCCCACCCCAAGTTGGGCTCGTCCTTTAACAGTTTTCTTCACATTGTCAATGAGATGCTTCCTTGCAGCCATCTCGA
ACGCTCCAGCGCCCAGCACAACAGCTTCATCCTCAACTGTGTTCTTCACAGATCTT
page-top