Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3305  (registered. 2012)
Contig Information
Length 678 bp
Clones alternative view 57 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 6
Wh_yd Spikelet at late flowering 5
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 7
Wh_MS Seed DPA5 of DT3DL CS wheat 11
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 8
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig3305
TTTTTTTTTTGAACACCACAACAGATTTACAACACGGCTGAATATAGATCTCTGATAACAACAGATAAGAGTGGCGATAGAGTGCCCTTACATCCCACAT
GCAACCACCGAAATTAGATCCCACAGAACCTGGATCCCCATTGTACATACAGTAGTGATCTTACATAACACACAAGCCAGGAATTACAGAGTACACCGGC
TAGTTAAAACATGCATGATATATAGAGTACTAGTAGATAGTAGAACTTGCAGGTGCAGTAGTAGATAGTAGAACATGCGGTGCAGGATAGATATTCCAGT
CATTCACCATTGAGCCATCTCCCTTCAACCGAGCCTATGGACCCCAAGCAAAAAGGTGAGTGCTCCAAGACTGAAGCCAGCACCACAGGCTAAGGCCTCG
TCCCTGCGCCTCTTCCTGTGTTTCTCTACAATCTTGTCCAGTGCCCGGCGAAACTCTGGGCCGAAGCCGAAGCGGTCGAAGTCAGCATCAGCAGGTGCCG
GAGCACGAGAAGAGACGCGAACCCGCTGGACAGCGGCGGGGATCTTCTGCTTCAGCTTGGCGGCCATGGTGCGCAGCGCCATAGCCATACCCTCCACCAA
CCCAAGCAGATCTGGACGACGGCGGCTAGGGTTTCCTTCTCTCGATCTCCAACACGCGAGCGGCACGAGGCCTCGTGC
page-top