Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33049  (registered. 2012)
Contig Information
Length 1267 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_EM Dormant seed with water absorption 1
Wh_KMP Shoot grown under continuous light 1
Wh_PCDAM Anther at meiosis 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XA Root 3
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115456247|ref|NP_001051724.1|| Os03g0821100 [Oryza sativa (japonica cultivar-group)]
Score 658
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33049
AGCCTGGTGTGCTCATCCAGGTGTTTGAGGGTGAGAGGACAAGGACCAGGGACAACAACCTGCTCGGCAAGTTTGTTGGCCCTGGTGATGGTGGAATAGA
AATCACCAGGGCCAGGTTTGAGGAGCTCAACATGGACCTCTTCAGGAAGTGCATGGAGCCAGTGGAGAAGTGCCTGAGGGATGCCAAGATGGACAAGAGC
ACTATCCATGATGTCGTGCTTGTTGGTGGTTCCACCAGGATCCCCAGAGTTCAGCAGCTGCTGCAGGACTTCTTCAACGGGAAGGAGCTCTGCAAGAGCA
TCAACCCTGATGAAGCTGTTGCCTACGGTGCTGCCGTGCAGGCTGCAATCCTCAGCGGTGAGGGGAACGAGAAGGTGCAGGACCTTCTCCTCCTCGATGT
GACCCCACTGTCTCTTGGTCTTGAGACTGCTGGAGGAGTCATGACTGTGCTCATCACCAGGAACACCACCATCCCCACCAAGAAGGAGCAGGTCTTCTCC
ACCTACTCCGACAACCAGCCTGGTGTGCTCATCCAGGTGTTTGAGGGTGAGAGGACAAGGACCAGGGACAACAACCTGCTCGGCAAGTTTGAGCTCTCCG
GCATCCCGCCTGCACCCAGGGGTGTTCCCCAGATCACTGTCTGCTTCGACATTGATGCCAACGGTATCCTGAATGTCTCTGCTGAGGACAAGACCACTGG
CCAGAAGAACAAGATCACCATCACCAACGACAAGGGCAGGCTGAGCAAGGACGACATTGAGAAGATGGTCCAGGACGCAGAGAAGTACAAGTCTGAGGAC
GAGGAGCACAAGAAGAAGGTTGACGCCAAGAACTCCCTGGAGAACTACGCCTACAACATGAGGAACACCATCCAGGACGAGAAGATCGCCTCCAAGCTGC
CCGCTGACGACAAGAAGAAGATCGAGGACGCTGTCGACGCTGCGATCCAGTGGCTTGACGCCAACCAGCTTGGTGAGGTTGACGAGTTCGAGGACAAGAT
GAAGGAGCTGGAGGGCCTCTGCAACCCCATCATCGCCAAGATGTACCAGGGCGCTGGTGCTGACATGCCGGGAGGCATGGACGAGGACGCGCCGGCTGCC
AGCGGCGGTGCTGGCCCCAAGATCGAGGAGGTCGACTAAGTTAGTCGCTTTCATATATGCCATTTGATTCAGTCCTGGGTGCCAATCATATCACCTGGGC
TGGAAGTTTTGTTGTACTTTTGGTCTGTAGCATCAGTGTCGTAAACAATGCAATGATGCATGTTTTG
page-top