Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33044  (registered. 2012)
Contig Information
Length 530 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23 11
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XV Leaves, plant was grown at constant 23 18
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|23954355|emb|CAD54079.1|| metallothioneine type2 [Hordeum vulgare subsp. vulgare]
Score 177
Evalue 4.00E-43
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33044
TTTTTTTTTTGACACTTTTTTTTTTTTAGGTTAAACCACGGGAGATTTTATTTAGGGGTCGGTTTACATGCATGGGAGTGCACCTGCTCTGCTCATGCTG
GCAGGTGCTTACATACATACAAAGACCCTCGATCAGGTAGCGTTACATGGTACTAGATGGATGGATGGATCGATCATAGATATGATGCATGCGCGCGGTG
CATGCATGATCGATGATCAATGATCTAGCAGCTGCAGCAGGAGCAGCCGCAGCTGGTGCCGCACTTGCACTGGGTGCAGCCGCAGCCGCCATCCTCCGCC
GCCATCTCCATCCCGCCGGAGCTCGCCTTGTGGGTGGCGGTGGCGGCGACGAGGAGGGTGGCGCCGGCGGCCTCGACCTCGGGGTACATGTTGCAGCCGC
CGCAGCCGTTGCCACACTTGCAGGCGCTGCCGCAGCCGCAGCTTCCTCCGCAGCAAGACATCTTCGAGGTTGCTTGGGATTGGATGGAGGCCTTGATTGG
TGTTGGCTTCTTTTGTGCTTCTTGCCCCGG
page-top