Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33024  (registered. 2012)
Contig Information
Length 970 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 4
Wh_r Root 2
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 1
Wh_VABA Shoot with ABA treatment 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_SP 2
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226499354|ref|NP_001147027.1|| polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 446
Evalue 2.00E-123
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33024
TCACCGGGAAACCTCCGATCCGAGCGAAGCGAAGGCTCTCTCGTCCTCCTCCTCAAGATGCAGATCTTTGTGAAGACCCTCACCGGCAAGACCATCACCC
TTGAGGTCGAGTCCTCTGACACCATTGACAATGTCAAGGCAAAGATCCAGGACAAGGAGGGCATCCCCCCGGACCAGCAGCGTCTCATCTTTGCTGGCAA
GCAGCTCGAGGATGGCCGCACCCTTGCGGACTACAACATCCAGAAGGAGTCCACTCTCCACTTGGTGCTCAGGCTCCGTGGTGGTATGCAGATCTTTGTC
AAGACCCTCACCGGCAAGACCATCACCCTGGAGGTTGAGTCCTCAGACACCATTGACAATGTGAAGGCCAAGATCCAGGACAAGGAGGGCATCCCCCCGG
ACCAGCAGCGCCTGATCTTTGCCGGCAAGCAGCTCGAGGATGGCCGCACCCTTGCGGATTACAACATCCAGAAGGAGTCCACCCTCCACTTGGTGCTCAG
GCTCCGTGGTGGCATGCAGATATTTGTGAAGACCCTCACCGGCAAGACCATCACCCTGGAGGTGGAGTCATCTGACACCATCGACAACGTGAAGGCGAAG
ATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGCCTCATCTTTGCTGGTAAGCAGCTTGAGGATGGCCGCACCTTGGCGGACTACAACATTCAGA
AGGAGTCAACCCTTCACTTGGTGCTCCGTCTCCGTGGTGGCCAGTAAGCTCCTGGCCATGGAGCTGCTTTTGTCTCTGGGTTCACAAGTCTCGTCTTCGG
TGTCCTCCAAAGGAGTCTGGTCTATGTCTGTCGTTGCCTGAACTGTCTTTGTTTCTATACCGTACTATGATGCAGTGTTATCGTTTGTATCTGCAAACTT
CTGCTGGTGTGCAGCAGCTTTGATGAACTTAATATTAAGTGAGCCCTGAATTCAATCCATAAAAAAAAAA
page-top