Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33000  (registered. 2012)
Contig Information
Length 1099 bp
Clones alternative view 70 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 8
WH_XE Seedling, infected with leaf rust 7
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 15
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 10
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 13
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|90398985|emb|CAJ86257.1|| H0801D08.15 [Oryza sativa (indica cultivar-group)]
Score 452
Evalue 3.00E-125
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33000
CGCCGTTCCCGTTCTCCTCTCCCCCTGTCGCCTCCATAGCAGCAGCAGCTCCAGCTCGAGCAAGAAAGAACTAGTTTGATCTGTGAAAATGTTGGCCATC
TTCCAGAAGCAGGTGGCGCACGCGCCGCAGGAGCTCAACAGCCCGCGCGGCAGCACCGCCAAGCCCAAGAACCCCGACGAGATCCTCCGCGACTTCCACG
CCGCCCACCCCTCCGACGCCTTCTCCACCTCCTTCGGCGGCGGCGCCGCCCTCGCCTGCGTCGCCGCGCAGCCCCGCAACCTCGCCGCCGGCGGGTACCA
GAGGATGTTCTGCGGGCTGGACGACATCTACTGCGTCTTCATGGGGACGCTGGACAACCTGAGCGCGCTGATGCGGCAGTACGGCCTCACGGGCCGCTCC
ACCAACGAGGCGCTGCTGGTGATCGAGGCCTACCGCACCCTGCGCGACCGGGGCCCCTACCCTGCTGACCAGGTGGTGAAGGACCTGTCGGGCTCCTTCG
CCTTCGTCGTCTTCGACAACCGCGGCCGGTCCGGCTCCGGGGCGGCCGTGTTCGCGGCGCAGAGCACGGACGGCGGCGTGCCGCTGCACTGGGGCGTGGC
GGCGGACGGGTCGGTGGTGATCTGCGACGACCGCGCCGTGGCCAAGGCCGGGTGCGGGCGGTCCTACGCGCCGTTCCCGCCCGGGTGCATGTTCCACAGC
GAGGGCGGGCTCAAGAGCTTCGAGCACCCCATGAACCGGCTCAAGGCGCTCCCGCGGGTGGACAGCGAGGGCGTCATGTGCGGCGCCAACTTCAAGGTCG
ACGCCTTCACCAAGATCAACTCCATGCCCCGCGTCGGTAGCGCCACCAACTGGGCCGCCACCTGGGACGAAGCCGCCATCTGATATAGCCATCGTCGCTC
CCCGGCGCCGGCGACGCTCGCCTAGCTCGTCGGACTTCTGGATTTGGGCTTACTGCATTTTACTTATTTTTTTCTTTGGCAATGTACATTCTGAATCTGA
TCTGATCTGAGCCGTGTGTGGGCGTGGGCACGCTGACACGTACGGTTGTTTGCTTGTACGATGGAGGAATAAGACTTTGCTTCCAGTCCAAAAAAAAAA
page-top