Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32970  (registered. 2012)
Contig Information
Length 1139 bp
Clones alternative view 723 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 6
WH_XI Two-week old seedlingsi22 16L-8Dj 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23 231
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 47
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 100
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 16
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 166
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 39
WH_XV Leaves, plant was grown at constant 23 71
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 15
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 22
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|3914470|sp|Q40070.1|PSBR_HORVU|PSBR_HORVU RecName: Full=Photosystem II 10 kDa polypeptide, chloroplastic;"
Score 244
Evalue 1.00E-62
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32970
TCGGCGGTTCGATCCCGTCATCACCCCCAACTACTTTATGTAGTCTCCGCCGTGTAGCAAGAAATTGAGAAGTGGGTGATTAGCTCAGCTGGGAGAGCAC
CTCCCTTACAAGGAGGGGGTCGGCGGTTCGATCCCGTCATCACCCACCACTTTCTCGCCAGCTAAATTTCTTGTAAAAATGTGAAGTACCGGAGAGGGAG
AGAGAGTGAGCCTAGTGAGTGAGCACAAACATGTCTGCCTCTGTCATGGCGTCTTTGGTTCTGCTGAAACCATCTCCCTCTCCACTGTTAGGACGAGCGA
AGCTCCGGGGTGTGCGACCATCGGCGAGGCCATCGCTGCTCATAGTAGCCAGCAAGAAGGCGAAGAAGGTCCAGACTGCCCAACCCTACGGGCCTGGTGG
TGGAGTGGTGTTCAAGGAAGGCGTCGATGCGTCCGGAAGGGCGGCCAAGGGGAAGGGTGTTTACCAGTTTGCCGACAAGTATGGAGCAAACGTTGATGGG
TACAGCCCGATATATACACCAGAAGAATGGTCTCCAAGTGGTGACGTTTATGTTGGAGGAAAGACAGGGCTGTTTCTCTGGGCAGTCACTCTTTCTGGAA
TTCTGTTGGGTGGTGCTCTTCTTGTCTACAATACTAGTGCCTTGGCTTCTTGAAGCCTGTGCGGCATACCAAAATATGCACCAGCGATGTGTATTGTACG
GGTTACAACCGTAACGACATATGTAACTGAATGTAAATACCAGTACCCGCAGTCAATAATACCGACAATTAATTACTAAAAAAAAAATGTAAGCAGCATG
GTGCAAGCATGATTAAGTTTTCAGTGCAAGCGCATGAGCTCTCTCGCAAATGTCATCAAGTTCTACAATGGCACTTGAATGTTCACAGAGTTTAATTCTG
CAAGTAAAGATGAAGATAAAGAACATGGTGCTATCACCTAAGTTACTAGGGCATCTCTACGCAGCGATTCGGCTCCTGAGCTCATCTTCTCCCAAGAATT
AACAGTCAATTCAAAAAAATATCAATTTTTTTGGCATGGAACATGATCGAGTGCGTGATGTCGGTGTCAAATTCGGTGGTGTATGGACCTTTGAGTAGGT
CTCGGCAGAAAAAAATGGGGGTTTGTGAGAAAAAAAAAA
page-top