Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32954  (registered. 2012)
Contig Information
Length 1002 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
WH_SP 2
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125560214|gb|EAZ05662.1|| hypothetical protein OsI_27889 [Oryza sativa Indica Group]
Score 290
Evalue 1.00E-76
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32954
TACGGCGTGGAGAACCCCATCTATGCTGTCATCCAACTTGCGCAGACAACCATGAGGAGTGAACTTGGCAAGATTACCCTCGACAAGACCTTTGAGGAGA
GGGACACGCTCAACACCAACATTGTGAAGTCAATCAATGAGGCAGCAGAAACTTGGGGTTTGAAGTGTCTTCGCTATGAAATCAGGGACATCACTCCCCC
AGATGGAGTCAAGAAGGCCATGGAGATGCAGGCCGCAGCAGAGCGCAAGAAACGTGCTCAGATCCTCGAGTCTGAAGGTGCTATGATGGAAAATGCAAAC
AAAGCAAAGGGTGAAGCTGAAGCGATTCTTGCCAGGTCGCAAGCCACTGCTGAAGGGATCAGGATGGTCTCGGAGTCGTTTAAAACTGAAGGCAGCACAG
AGGCTGCCAGCTTGAGGATTGCTGAACAGTACATCAGAGCATTCAGTGAACTGGCTAGAAGTACGAACACGATGCTTCTTCCCAGCGACGCAGGCAATCC
GGGGACAATGATTGCTCAGGCGCTCCAGATATACAACCACACGTACAAGCAGAAACTGACGCTGGGAAGCCCCGGCCCCAGCAAGCGGGCAGAAGAGGCT
GATTTGTCCCTTGGGATGCCATCCGTGAGCGACCTCGGCACCTTTGAGCACCACAAGTAGAGTATTGACTATTGAGTGGGGAATCTTCTCTTTTTTTCTT
TTTCTCTTCTGTTAGGGAGGAGAGGAATGAATAGCTAGACTGGATAGATAGATTGCTAGGGAGGCAGCGCAACTTTGTCACGAGTGAAGATTTACTGATT
AGGTCGGTCGGTCGGTTGGATAAAACACAATACTCTGTTCCTGTTGGTTAGGAGCAGCTTTGAGAGAAAGCTTTTTATCTGTCTATATGAATTGAGTGGT
GAACCTTTAGATTTTTTAGTTTAACTGAAACACTGTTTTCAGCTTTTCTTAAAAAGTTTTTGTTGGGTCAGTTTTTTTGGCATGAAATCTGATAGTGTTT
AC
page-top