Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3295  (registered. 2012)
Contig Information
Length 543 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_DPA20 Seed DPA20 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig3295
AAAAAATCTAAGCACTGGACAAGAGATCGAAACCGGTAATTAACAACATACAGACAGTATTTGATGTGTTTATGGCTGGCAGCAACACCAACACCGACGA
GTTGTACATGCAGAATGTCTACAAACTTTCAATATAACACCTATACAAATGGTACCAGGGGCCTAACCAGTCACGCTGCTGCTCATCCTATCCGACCGTA
ATATAATATATATAATATAGCAATCCTGTAATTAACTCAAACTCGGCTAGAGATTTCGCTTGCCAAAATTGTCCTGGTACCAAAAGAATATCAACTGGAA
CAACCAATGACGCAGATATACACCTTGGAGGATACCTCTCCGGGATAGATATTCATGATTGTCTCCCTCCCTCTGCGTCAACTGAAATACTTCACATCAT
CTGTACTCTTCAAATTCATACAACAGAGGTTGGTTGACTCAGTAGCTTCCCATTGGAGGCATCCCGTATGCTGGCATTGGACCAGGACCCATCGGAGGCA
TACCCATCCCGCCCATCGGCGGCATGCCCATTCCGCCCATCGG
page-top