Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32944  (registered. 2012)
Contig Information
Length 879 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 1
WH_XN Leaves, plant was grown at constant 23 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 12
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 6
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1657859|gb|AAB18209.1|| chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 518
Evalue 3.00E-145
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32944
TCATGGTAGTACATATCAGACCGCACGACGACACACCTCACCGCAAGCAAGGCAGATTACTTCCCGGGAACAAAGTTGGTGGCGAATGCCCAAGCATTGT
TGTTGACGGGGTCGGCGAGGTGATCAGCGAGGTTCTCGAGTGGACCCTTGCCGGTGACAATGGCTTGCACAAAGAAACCAAACATGGAGTACATGGCGAG
ACGACCGTTCTTGATCTCCTTGACCTTGAGCTCTGCGAATGCCTCGGGGTCGTCGGCAAGGCCGAGCGGGTCGAAACTGCCGCCCGGGTAGAGCGGGTCT
ACGATCTCACCGAGTGGCCCGCCGGCAATACGGTAACCCTCGACGGCGCCCATAAGCACGACCTGACATGCCCAGATGGCAAGGATGCTTTGCGCGTGCA
CGAGGCTTGGGTTGCCGAGGTAGTCGAGGCCACCCTCGCTAAAGATCTGGGATCCGGCCTTGAACCAAACAGCCTCACCAAATTTAACGCCGTTGCGGGC
GAGCAGCTCGGGGAAGACACAACCGAGCGCGCCAAGCATGGCCCAGCGGCAGTGGATCACCTCCAGTTCACGGTTCTTGGCAAAGGTCTCAGGGTCGGCT
GATAACCCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCGCCGGTGAGGTAGCTCGGGGGCTCGCCAGAAAGCGGGCCGAGGTAGAGCACGCGGTCAG
AGCCGTACCACGGGCTGCTGGAGGCGACCTGCTTGGCCTTTGCCGCTGTCTTGCGCATGGTGACGCGAGCCTCCCCGAAAAGAAACGACGATGGCAGGTT
CTTCACTGCCTTGCCGGCAAAGGCTGGGGAAGAGAGTGACATGGTGGTTGCAGACATTCTGATCGATGGAGGTTCTGTG
page-top