Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32900  (registered. 2012)
Contig Information
Length 1221 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|116283512|gb|AAH29790.1|| Unknown (protein for MGC:35458) [Homo sapiens]
Score 367
Evalue 2.00E-99
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32900
GCACAGCCGCGCATCCACCGTTGCTAGCAAGGTCGACCAAGCAGCACCGAGATGGCTGCTGCCTTCTCCTCCACCGTCGGTGCCCCGGCTTCTACGCCGA
CCAACTTCCTCGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCTCCAAGGCCAACAGGTTCACAGTCATGGCAGCGGA
AAACATCGACGAGAAGAGGAACACAGACAAGTGGAAGGGTCTTGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGAGGGAAGGGCATCGTGGAC
TCCCTCTTCCAGGCGCCCACGGGCGACGGCACCCACGAGGCCGTCCTCAGCTCCTACGAGTACGTCAGCCAGGGACTCAAGAAGTACGACTTCGACAACA
CCATGGGAGGCTTCTACATCGCTCCTGCTTTCATGGACAAGCTTGTTGTCCATCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGATCCCACTCAT
CTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAGTGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTACCGGTATC
GAGAACATTGGCAAGAAGCTTGTGAACTCGCGGGACGGACCAGTGACCTTTGAGCAGCCAAAGATGACAGTCGAGAAGCTGCTAGAGTACGGGCACATGC
TCGTCCAGGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTGACACCTACATGAGCCAGGCAGCTCTGGGTGATGCTAACCAGGATGCGATGAAGACTGG
TACCTTCTACGGTTAGAACATTCTCCATACACACCCACCATCTCTTGCTGCATAGGAGGAGGTGAACTACGCACAATCCTTTTATACTTTCAGCACCTAC
TTTACATACTTACTTACTTCTCACTTGCTTACTTCTGAAACAAAAGAGTGAATCATAAACAAACAGTGGAGGCCTATTCTTCTTACCTGTTCTTCTGGCA
TATCAAGCTCATCTTTCTCATCAGATCGTCCAAAACAATTAAATTGCAGGTAAAGGGGCACAGCAAGGTACTTTGCCTGTACCGGCAGGATGCACCGACC
AGACTGCCAAGAACTTCGACCCAACGGCGAGGAGTGACGACGGCAGCTGCCTTTACACCTTTTAAGCATGCCAATTTAATATCTGATGTTTTATCCTTTG
TACCTAAGTACCGCATCGCAT
page-top