Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3287  (registered. 2012)
Contig Information
Length 756 bp
Clones alternative view 98 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 8
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_SH - 1
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 8
Wh_SHC Shoot grown with cold treatment 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_SP 1
WH_XA Root 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 12
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|224138380|ref|XP_002326588.1|| predicted protein [Populus trichocarpa]
Score 151
Evalue 8.00E-35
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3287
TTTTTTTTTTGGATAGAATTAGAATTCAGAAGAATTTATCAGGAACCGGTATTCCCCAAAGGAAAAAAACATCTTAACAACAGAAGACATGTAGGAGTAT
TAATCAATCATGGCGTAAACTGAGATTGCACTTTCATGTATCACAGGGCTTCTTGTTCAACGTAATTACACCCACGACGGCGATAAGCTCGACAACAACT
AGTACTTGAAATTTATTTGTGTTTGCTGGCACACATGTCTGCACCACCAGGATAGCAATAGCGATTGCGGTCTTGTGGCCTAGGATTAAGCGGATGCGGC
GGCAGCCTCCTCCAGCAGCTGCTTCACCTTGGTGATGTAGTCCGCCATGGCCTCCTCCTTGGATTTGGCTTCGACGGCCTTCCAAGCATCCCACTTGGCC
TTGCCAGCCATATCGAAGAGGCCGCCGGGGCGGGCGGTGTTGACGGGGCCGACGGTGGCCTGCTTGTAGAGGCCGTAGAGGCAGAGCTTGCTCTCGTTGG
TGGTGGTGTCGGGCAGCGTCTTGGCCTTCTCCGCGTGCTCCTCAAACTCCTCCTTGAGACCCATGTCGATCGGCGGCTCGTCGGCTGCTCCGCTCTCCTC
TCCTGGGCTTCGATACGTTCGAGGCGATAAGAGCGATCGATTCGATCCTCGTGCCTCGTGCGGCACGAGGACCGCAGATCAAGCAAAACAACTTGCAGAG
TTTCCGGAAGTAATCAGTGTCCAACCGAGTAAAAGGCACACGCCAACCACTACACG
page-top