Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32859  (registered. 2012)
Contig Information
Length 890 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 3
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218196969|gb|EEC79396.1|| hypothetical protein OsI_20321 [Oryza sativa Indica Group]
Score 384
Evalue 1.00E-104
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32859
CTGGGACAGCATAACCATTGCATACTTGTCAATTTTCTGCAGCTGCTGTGTTTTCGGGTGGAACGTGCAGAGGCTTGGATTCGGCAACATGTACGTCCAC
ATTGCAACATTCCTGCTCTTTTGCCTGGCTCCGTTCTTCATCTTCAACCTGGCAGCAGTCAATATCAACAACGAAACCCTGCGAGAGGCGCTGGGGCTTA
CCGGCATCGCGCTGTGCTTCTTCGGTCTGCTGTACGGTGGCTTCTGGAGAATACAGATGAGGAAGAGATTCAACCTCCCCGGGAACCCCTTCTGCTGCTG
TAACCCCGATGTGACGGACTGCTTCCAGTGGCTGTGCTGCTGCTCATGCTCTCTTGCTCAGGAGGTGAGGACCGCTGATTACTATGACATTGCAGAGGAG
AGGTCATACAGAGGGCAGGTAAACGGGGAGAGTCAGCGTGTGATGTCCCCATTGGCTCGTGAAGACGGTCTGCCGCTTTTCAAGTCAACTCCAGCTTCGC
CGTACAGGAGTAGCACAGGCACGGCTGGTCAGTCCATTTTCATCATGGAGAGCCCATCAGCTCCGCGGAGGTCGTCCGGTGCGACCCCTCTCGGTGCTTC
GCCGACGAACGGCGGCGACAGGGCGATGAAGGCGCCTGCTCCATCTGTCTTGCACAGAGAAGGTGAAGATGAATCGTAGTAGCATGTGGCGGCCCAGCAA
TTCGCTTATCATGAGGTGAGGTGACTAGTCTTGCTCAGTCCATGGAGATGGACATGTATATTTGTTGTAAAGAAAATTTACCACGCCTCTCTTCATATGC
GGCCAAGTTCTTTTTTTTTGGGGGGTGCTAATCGCTCTTCCGTGAGAGATGCATTAGAGTATTCAGTTCTGCTCTACTGTGTACGTAATT
page-top