Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32843  (registered. 2012)
Contig Information
Length 1066 bp
Clones alternative view 35 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 3
Wh_yd Spikelet at late flowering 2
Wh_VSCB Liquid cultured tissue 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_CA 1
WH_SP 4
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|3122234|sp|O24473.1|IF2B_WHEAT|IF2B_WHEAT RecName: Full=Eukaryotic translation initiation factor 2 subunit
Score 541
Evalue 7.00E-152
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32843
TAAGAGCTGTCGACGACTGAAACCCTACCCGGAGCCCCGCCGCCGTCGCCTCTCCCTCTCGCTGTTTAGAGCCGTCGCGCCGCCAGCAGAAGAGGGGGTG
AAGAAGGCCAGCGTCACCATGGCGGACGAGGAGCAGATGGAGCGGAAGGAGGAGGCAACCGAGATTGCACCTTTTGATCCAACCAAGAAAAAGAAGAAGA
AGAAGGTCGTCATCCAAGATCCTGCTGATGAGGTTGATAAGCTGGCAGAGAAGACGGAGGGCTTGTCAGTCACTGAGTCTGGTGAGGCAAGCTTCGTGGG
ATTGAAAAAGAAAAAGAAGAAACTTGTGGAACTTGATCCATCACTTGTTGAGGCTGGAGATGGTGAAGACACTCTTGATGATCAAGTTGGAGAGGATGAA
CAAGGAGAAGGGATTGTGCTGGGTGGAGCAACCCAATACCCATGGGAAGGAACTGATAGAGATTACAAATATGATGAGCTGCTTGGCAGAGTCTTCAATA
TCCTGCGTGAGAATAATCCAGATCTTGCTGGTGATAGACGAAGAACAGTTATGCGGCCTCCTCAAGTTCTTAGGGAAGGCACAAAGAAGACAGTTTTTGT
GAACTTCATGGACTTGTGCAAAACAATGCATAGGCAACCTGAACATGTGATGATGTTTTTACTTGCTGAGATGGGAACAAGTGGATCCCTTGATGGGCAA
CAAAGGTTGGTTATCAAAGGAAGATTTGCCCCGAAGAACTTTGAAGCTATACTCAGGAGATATATCAATGAATATGTCATATGTAATGGATGCAAGAGCC
CAGATACCATCCTTTCCAAGGAGAATCGGTTGTTCTTCCTTCGTTGTGAACAATGTGGTTCGTCAAGGTCAGTTGCTCCTATCAAGGCTGGATTCGTGGC
GCAAGTTGGGCGTCGGAAGGCTGGAACTTAAAAGTTGGGTAGTGCGCGGATGCTCTATCAACGTAATCCAGCAATTTGCCGATTTACAACAATCTTTATT
GTCCTGTTTTCACTGTGCCTAGACCGCTTTGTGGATTTTGTTACTTCCTGTACTATGAATGCTGCT
page-top