Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32839  (registered. 2012)
Contig Information
Length 647 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242052961|ref|XP_002455626.1|| hypothetical protein SORBIDRAFT_03g014800 [Sorghum bicolor]
Score 174
Evalue 5.00E-42
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32839
GGACCTAAGTTTCATTATTCTTGCGCCCACTTTTGCATGATATTTTACATGTCTTTGTTGTCTGCAGGACCGGAAACTAGTTATTACATTCTGTAACACC
TATACCGGACACGTCGACTTGCATGGTTTGCCTTAGTCTTCGTCATCACGTGATACAAGATAACAGAAACACGGAACATAGGTGTTGCGTGTATATTATT
CTCCCGTGTCAGCTGCATGCGGCCGAATATCTACAAAGCCCTCCTGTGAGCTACACCCAGACAGCACCTGCATTACGAAGCAGTGGGACAAGCTTGCCGC
TGAGGTGAAGGGACATGACCTTGTCGGTGCATCCGACGAGCCTGCCGCCGATGAACACCGCCGGCACGGCAGGGTTCCGGCCGATGAGTCTCACCAGTGC
CTTCTCCATCTCCTTCCCCCTAGGGTCCTCGTCCAGTTCCACCATCATCGGGTTCGCCCCGAGATCCCGGAGGAGGCTCGTCACCGTGTGGCACATGCAG
CAGGAGCTCATGCCGAAGATCACCACCGCCCGCTGCCCCGCTAGCCTCGTCACCTGCTCCATCAAGCTTAGTTCTAGTGCTAGTGCTAGTGAGCTCAATT
AGTAGTACGATTGCTCCTCGTGCCGAATTCGGCACGAGGCCTCGTGC
page-top