Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32830  (registered. 2012)
Contig Information
Length 1284 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 2
Wh_VWD Shoot grown with dessication 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XV Leaves, plant was grown at constant 23℃ 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125558308|gb|EAZ03844.1|| hypothetical protein OsI_25975 [Oryza sativa Indica Group]
Score 437
Evalue 2.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32830
GCACAGATAGTGCATCAATGGCCTCCACCGCCCAGCTTCTCGGCCACCTCGCCGGCTCCACCGCCACAGCCAGCCTTAGCTTCACGCCTGTCAGCGGCGG
CGGCAGCAGCAAGGTCAGGTTCCTGCCGGCGACGGCGCAGAGGCGCCGCGTGGTGGCGCGCCCGCGGGCCGCGGTGTCCGGCGCGGAGAAGGAGAAGGCC
AAGCCGGCCGAGTCCGGAAGCAAGGAGGACGAGCGCGTGGTGCAGGTGCACAGCGCGGAGGAGTTCGACAGCGCGCTCCAGAAGGCCAAGAACAGGCTGG
TGGTGGTGGAGTTCGCGGCGAGCCACAGCGTGAACAGCAAGCGCATCTACCCGTGCATGGTGGACCTCAGCCGCACCTGCGGCGACGTCGACTTCCTCCT
CGTCATGGGCGACGAGTCGGAGGCCACGCGGGAGCTGTGCCAGCGGGAGGGCATCACCCAGGTGCCGCACTTCTCCTTCTACAAGGGCACCGAGAAGGTG
CACGAGGAGGAGGGCATCGGCCCCGACCAGCTCGCCGGCGACGTTCTCTACTACGGCGACAACCACGCCGGCGTCGTGCAGCTGCACAACCGGGCGGACG
TGGAGGCGCTCATGGCCGAGAACAGCGGCGAGGACGGCAAGCTGCTGGTGCTGGACGTCGGGCTCAAGCACTGCGGGCCCTGCGTCAAGGTCTACCCCAC
CGTCGTCAAGCTCTCCCGCTCCATGGCCGACACCGCCGTCTTCGCGCGCATGAACGGCGACGAGAACGACGCATGCATGCAGTTCCTCAAGGACATGGAG
GTCGTCGAGGTGCCCACCTTCCTCTTCATCAGGGACAAGAAAATCGTGGGCCGCTACGTCGGCTCCGGCAAGGGCGAGCTCATCGGCGAGATCCTCCGCT
ACCAGGGCGTCAGGGTCACATACTAACTAAGGGAACCACCAAGCCATCACCACTCACCAGCCGAATTAAGTTGGATCATCCCTAGTTCCCTACCCTACAC
AGTCACAGGTAGCAGTAGCAGCACAAATGAATTGAGAGACAAGCAATTGATGCTTCATGTAATTCTATACTATATATACTTGTTACTGCCGCATCAATCG
ATGCTATAGGTTCATATTTAGACATTTTCATCATGCTCTTAATTACCTGGTATTGGGCGCCAATCACATACGGTTATAGCAGTAATAGAATTTTCGAGTG
CAAATTGTAATAAGTTTATTATATTGTTTTTACTGTGATATAATCGGAGCTTTGCCATCCTATTTTTTTTTGATAAAAAAAAAA
page-top