Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32776  (registered. 2012)
Contig Information
Length 1101 bp
Clones alternative view 92 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_SH - 12
Wh_KMP Shoot grown under continuous light 5
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 9
WH_XN Leaves, plant was grown at constant 23Ž 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 9
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 14
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|225690802|gb|ACO06087.1|| chlorophyll a-b binding protein [Triticum aestivum]
Score 517
Evalue 1.00E-144
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32776
TTTTTTTTTTGTCCCGTACAAATAACAGAGATTGTCAGAGGCAACTTCCTCCACACCATCATCATGCAAAGAGTTTATACAGATCATATGGATGCATTCA
CAACAGTGGCCGCTAGTTAAGCTTTACACATTACAAAGGTTGCCGGCCGGAGAGCCGACGTTGTTGTACAGTTCCTGCACGCACGGACGTACGCGCGCAG
AGCCAGCGTGGCAAGGCAATCAACCAATCTATCGATTCAGAAACATGAATGAAAAGTTGAAAACCATGCGCTCCAGCTCCTCGATCTCCTCTCAGCCCGG
TCGGCTCCGCTCAAGGGCCGTAGATATTTCTGGGGATGACGATGTCGCCGATGTTGTTGTGCCACGGGTCCGCGAGGTGCGTGGCCAGGTTCTCCAGCGG
GCCGGTGCCGGGGTACGCCGACTGCTGCACGCAGAACCCCACGAACGCCAGCATCGCCAGCCGCCCGTTCTTGATCTCCTTGAGCTTGAGCTCCTCGAAC
TTGGCGGGGTCCTTGGAGAAGCCGAGCGGGTCGAAGGCGCCGCCGGGGTACTTCTTCTTCTCCGGGTCCTTCTCCATGGTGCGCTGCTGCTCCGCGAAGG
CGATGGCCAGGAACTCGATCGCCAGGATGGTCGGCAGGTTGCCCCACGGCACCGGGTTGCCCAGGTACGTCGCCTGCCCGTCGGGGAGCGCCGCCCACTC
CTGCGCCTTCACCCAGTTGCCCAGTCCCAGCGCCTCCGGCACCAGCACCCCAGGCACGCAGAGCATGGCCCAGCGGCAGTGGTAGATCTCGGACTCCTTG
AACCGCTCGAAGTTCTCCGGCACGGTGGCGAGGCCCAGGGGGTCGAACCCGAAGTCTCCTGGCGAGGAGCCGTCGAGGTGGGCGGGGCGGGGCTGGCCGG
GGAACCACTCGGCGGACATGGTGACGCGGCCGGAGGTGGTGGCGTAGGCGCAGAACGGCAGCCCGGAGCGGCCGGACCTGGACGAAGGCGCCAGCAGGCT
CGGCACGCCCACGGCGCTGCAGCTCCTCAGCCCGCTCGACGACGCCATCGCCATTGTTGCTCCCTCGATGCTGGCTGCTCCTTGCTGCGGTGAGACAACA
A
page-top