Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32772  (registered. 2012)
Contig Information
Length 1753 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_CSEC Callus 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 1
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218189769|gb|EEC72196.1|| hypothetical protein OsI_05274 [Oryza sativa Indica Group]
Score 907
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32772
GCCCCCACCAACCCAATCCTCGCGTCGCGTCCCCTAAACCCTAACCCGCCGCGAGGGGAAAGCGCCGGAAGCCATGGCGACGGCGGCGCCGGGGCAGCTC
AACCTCGACGACTACCCGTCGTGGGGCTCCCGCGGCGTCGACTGCTTCGAGAAGCTCGAGCAGATCGGGGAGGGCACATACGGGCAAGTGTTCATGGCCA
AGGAGACGGAGACCAAGGAGATCGTCGCGCTCAAGAAGATCCGCATGGACAACGAGCGCGAGGGCTTCCCTATCACGGCCATCCGCGAGATCAAAATCCT
CAAGAAGCTGCACCACCAGAACGTCATCCAGCTCAAGGAGATCGTCACATCCCCAGGGCCGGACAGAGACGAGCAGGGGAAGCAAATCGATGGCAACAAG
TACAAAGGGAGCATTTACATGGTCTTTGAGTACATGGACCATGACTTGACTGGGTTGGCTGATAAGCCTGGGATGCGCTTCACCATTCCACAGATTAAGT
GCTACATGAAGCAACTCCTCACGGGCCTTCACTATTGCCATATCAATCAAGTTCTGCATCGTGATATTAAAGGATCTAACCTCTTGATAGACAACGAGGG
TAACTTAAAACTGGCTGATTTTGGCCTAGCAAGATCATTTTCGAGTGATCATAACGCAAACCTCACTAACCGTGTGATCACTCTGTGGTACAGACCTCCA
GAGTTGCTGCTAGGAAGCACAAAATATGGGCCAGCGGTGGACATGTGGTCGGTGGGTTGTATTTTTGCAGAGCTTCTCAATGGAAAGCCAATACTGCCTG
GAAAGAATGAGCCAGACCAACTGACCAAAATATTCGAGCTTTGTGGTACCCCTGACGAATTGATTTGGCCGGGTGTGACAAAAATGCCATGGTATAATAA
TTTGAAGCCTCCCCGCCAATTGAAGAGGCATGTTAAGGATGCTTTTAAACATTTTGATTTTCATGCTCTGGATCTGCTGGAGAGGATGTTAACATTGGAC
CCGTCAAAGAGGATATCTGCAAATGAAGCTCTTGATTCTGAATATTTCTGGACTGATCCCCTACCATGTGATCCTAAAAGCTTGCCAAAGTATGAGGCTT
CACATGAATATCAGACAAAGAAAAGACGTCAACAGCAGCGGCAAGCTGATGATGCTGCTGCAAAGCGGCAAAAGACGCATCATCCTCAGCCTCCTCATGC
CCGTTTGCCCCCAATCCAGCAATCAGGCCATCAAATAAGGCCAGCCCAGCCTACCAACAACCCGCATCCACCAATGGCATCTGGGTCAAATCATCACTAT
GGAAAGCCCCGAGGGCCAGGAGGGCCAAACAGGTACCCACCGGGCGGGAACCAAGGTGGTGGAGGGTATCCGAACCGTGGAGGGCAAGGTGGCGGCTATG
GGAGTGGCCCTTACCCCCCTCAACAAGGTCGAGGGCCTCCTCCGTACCCTGGCGGTGGCCCAAGGGGTGGCGGCAGCAGCGGTGGCTATGGTGGTGCTCC
AAACTTTCCACAAGCCGGTCCTTATGGTCCTGGCGGCGGCCCAGGCCGGGGGCCAAATTATCCCCCACAAGCTGGCTCTCGAAACCAGCAGCAGCAGTAT
GGAAACTGGCAATAGTATGTAGCATCTCAACAATACCATGTCATGTAGATTTCTTTTTCCTTTTCAAGAAGGCCATGGCATGTAGGAATTGCCCATGATA
AGTGGAAACCTATGCGCTGATACTTGTATTTCAAGTTTAATTCAAAAAAAAAA
page-top