Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32737  (registered. 2012)
Contig Information
Length 1356 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115477525|ref|NP_001062358.1|| Os08g0535800 [Oryza sativa (japonica cultivar-group)]
Score 254
Evalue 2.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32737
CTCTCTCTCCGTAGTCTACACCCTCTCCCTCTCTCTGTCTCTCTCTGCAAGTCGCCATGAACATTCCAAGCAAATGCACGACCCATGGGCGCCACTTTGC
ACTTGCAAAGTGAGATAGGAAGCTGCGGCCTGCCCTGCTCCCTTTACCACTACCGTGCAAGGACGTCCCTGTGAACTACAAGCTACACCTAGCTAGTGCG
GCTATTAGTTCGTACATACGTGCTCGAGCCACTGAGCTGAGCTAGTTTGTGCGTGCTATTACAAGCTGTTGCCAGGTGGTCAGCGGCAGCCATGGAGAGG
ACGCCGGTGATGGTGAGGCAGGGCGGCCAGGAGGTGCTGAGGCAGCTGCCGCCCGGGTTCCGCTTCCGCCCTACAGACGAGGAGCTGGTTGTGCAGTACC
TCCGCCGAAAGGCCCTTGCCCTCCCGCTCCCAGCTGCTGTCATCTCCGATGTCCACAACCTCTACAGCCTCGACCCCTGGGACATCCCCGGCGCGAGAGA
GGGGGAGAAGTACTACTTTGCGGTCCGGCCGGCCGCCGGCGCCAAGAGGGGTGGCAGGACCACGACGGCGAGCGGGTGCTGGAAGCCCGCGAGCGCGAGG
GAGAGGCCGGTGGTGGTGTCCCGGTGCGGCCGGAGCCACCTCGTTGGCGTCAAGAAGTTCCTGGCCTTCGTCCCCCGACGTGGCAAGGGCAAGGGCTCCA
AGGCGCCGCCGGCGCCAGCGCAGATCGGCTGGGTCATGCACGAGTACCGCCTCGCCCTGCCGCATCACCACAAGAATGGTTGCTGCTTGGCTGAGGCTGG
AACACAAGAGTGGGTAGTGTGCCGGATCTTCCAAAGGGACAGATCGTCGTCGTCGTCCAACAGACAAACGCCGGGCATCCACGGCACCGACGCGCACCGC
ACGATGCCACCGATGCCACCATCGCCATCGTCGTCGTCTTCCAGCTGCGTCACAAGCGGCGGCAGCTCCTCAGACCTGCAGGAAGAGGTCAGCAGCTGAG
AAGCCAAGCAAAGCTGCTGCCTACTGCCTCTCCAAGAGACACTGACTAGCTAGCTTAGCTAGGCAGATTACGAACCAGGGGAAAGAAATGATGTGTCCTT
TTCTTGCTCCAACATTTGTTTTTCTCTCCATCTCTTTGCTCTCTTTCTCCGTGTAATATGTAATGCAGTGTGATGATGTAGCGAGAAGCAAGTCAGCAAC
CAGGCATTGGGTGTTTAGTTAATTAAGAAAGCCTCCTCTGATTAGTAGCAGATGTACCATGCATATGTGATATGTGTATGTATACGTAGCAGAGATGCAG
CACGCAGTGACCACTGCATGCATGTGTAATAACCTGCGAGCTGTACGTGAAATTTC
page-top