Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32716  (registered. 2012)
Contig Information
Length 1052 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_EM Dormant seed with water absorption 2
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|20152873|gb|AAM13409.1|AF408843_1|AF408843_1 sucrose transporter SUT1B [Triticum aestivum]
Score 530
Evalue 9.00E-149
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32716
TTTGCTACACACAAGTCACAACCCAAAGACGACACCCCAGCCGGTGATGGATGCCCACATTCCTCTGTCCATTTTCTGCTACACGCACTGACTTACACGC
ACATACAGACACAACACATACGGTTCCTCACAATTCTTATTCTGCTCTACGGAGTCCTTAGGCGAGAGCCACCTAGTTACGCCTATGCGAAAATTTGGTA
AATGGCGGGCTGGGCTGGGACCTCCGGCCTTGGCCATGCTCAGGCCGACCGACGCGCGGCGCGGTCAGTGACCGCCGCCGCTGACGGCCCGGAACTGGCG
CCTGGAGATCTTGGGCAGCAGGAATATGCCGACGATGCCGCCGATGAGCGCGAAGGCGGACGCCATGCCGAACGCCGGGATGTTGCCCTTGCCGAACAGC
TCGTCCCACGGCCCCGCCCCCACCGCGATGATCACCTGGGGTATCACGATGGCGATGTTCAGCACGCCCGTGCACAGCCCTTGGCCACCGCCTCTGTTCG
CCGCCAGCTGCGCCGTCACCGCGAAAGGGACACTGTACAGAATGGCGAGAGGGACTCCGAGGAAGGCGAAGAGGGCGAGGGAGACGATCTTGATCTCCTT
GCTGGCGGTGATGGCGTGCTGGATGTACCCATGCATGTCCTGAGTAGCCCACCAGCTTATGATGCAAATGGCCGCCATGGAGAGGCAGACGAGGAAGTTG
CTCGACACCCACACCACCCGCGGGCCTAGCCTCTTGCACAGCGGCTCGATCAGGAACGAGCTGAACCCCAGGACGACCGAGTTGAGTAGCAGGCCGAACG
CCCCGGCCCTGACACCTGCCTGGAACGCGTTGGCCTCGTCGGGGGTTCCCTTGGGGTCACCGTGGTAGATCTCACGACCCATCCAGTCGGTGTCGTACAG
GATGAAGGGGAACCAGGACAGCCAGGTGAGGCCAGTGACGAGGAGCACCGACGGCATTCCAGGAGGCAAGTTCTTGAAGCCTTTGAACACGGCGAGCGGC
CCGGTGGGCTCGACTTCAACCTGGCCATTGGCCTTTGTTGGGAGGGGCGCAA
page-top