Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig327  (registered. 2012)
Contig Information
Length 882 bp
Clones alternative view 91 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 12
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 2
Wh_r Root 5
Wh_yd Spikelet at late flowering 6
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 3
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XA Root 11
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XD Root, treated at 50 microM Al for 6h 8
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57471698|gb|AAW50980.1|| ribosomal protein L36 [Triticum aestivum]
Score 211
Evalue 9.00E-53
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig327
ATGTCAACTGGGCTGAGCACCACAACGTCTCCATGCGTTATGTATGCGAAAAATAAATGGCCAAAAAGGCAACGAAATCATTATGTCAGGCGAATTGCTC
GCATAGCACGATGTGGCTCTCGATCTTGTCCAGGCATAAATCGCTAGCATTTGTGTATAACAACGGTTCTTCTTACCTACAAACACAGCGTGTTTGATAA
ATTAATTCATATTCAAGGAGCCTACATCACAGAAATTACGCACACATACGCCAATTGTAAAGCCACTGGCATAAGAATGGCAGTTGGAATCAAGCTGACA
GATCATAGAAGCAATTTTTTTTTTAGGGTGGCAAACGATGCATTGCAAGTTAGCTCAAAAATCTCACAAGACAGGAGGTTCAACATAGCATAATGTTTAG
CTGGCGGATAACAGTTTCAAGTCTAGCAGGTTCTACATGCAGTAAAAACCGGACACCAGAACAGAAGATTTTCCATCAACTTCATGAGCCTGGGATGCTC
TATTTCTTCTTCTCGGTTCCAGTTCCAGCAGATCTCATCTTCCTGAGGACACTGGACATCTCCTCTCTCTTCTTCTTCGCCCTCTTGTGGGTACCCAACT
TTCGCTTCGCCACCTTCAGGGCACGCTTGTCCTTGCCAACCTTGAGAAGCTCAGTGATACGCTTCTCATACGGAGCAAACCCAGCGACCTCCCTGATCAA
GTTCCTGACGAAATGCACCCTCTTGGTACCTTTCCCCTTGCGGTCGGACGGGCGTGGCGGCAGCTCGCGCTTGGTGACGACGTGGCCCTTGTTGATGCCC
ACGAAGAGGCCCGACTTGGGCTGCGACGGAGCCATGGGCGAACCTTTCCTTTACCTGGGAGAAGCCTCGTGCCGCCTCGTGC
page-top