Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32671  (registered. 2012)
Contig Information
Length 2078 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_r Root 2
Wh_RDr Root of dessiccated seed 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115464201|ref|NP_001055700.1|| Os05g0449500 [Oryza sativa (japonica cultivar-group)]
Score 1041
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32671
CCCCGGCGGGCCGGCGCGGAGCCTTAGGCGGGGATGGGCGGGGAGGCCCCGGAGCCGCGGCGGCTGAGCCGCGCGCTCAGCCTGGACGGCGGCGGCGTCC
CGGAGGAGGCGCTGCACCTGGTGCTCGGCTACGTGGACGACCCGCGCGACCGCGAGGCGGCCTCGCTGGCGTGCCGCCGCTGGCACCACATCGACGCGCT
CACGCGGAAGCACGTCACCGTGCCCTTCTGCTACGCCGTGTCCCCGGCGCGCCTGCTCGCGCGCTTCCCGCGCCTCGAGTCGCTCGGGGTCAAGGGCAAG
CCCCGCGCCGCCATGTACGGCCTCATCCCCGACGACTGGGGCGCCTACGCCCGGCCCTGGGTCGCCGAGCTCGCCGCCCCGCTCGAGTGCCTCAAGGCGC
TCCACCTGCGCCGCATGGTCGTCACCGACGACGACCTCGCCGCCCTCGTCCGCGCCCGCGGCCACATGCTGCAGGAGCTCAAGCTCGACAAGTGCTCCGG
CTTCTCCACCGACGCCCTCCGCCTCGTCGCCCGCTCCTGCAGATCACTGAGAACTTTGTTTCTGGAAGAATGTACAATTACTGATAATGGCACTGAATGG
CTCCATGACCTTGCTGCCAACAATCCTGTTCTGGTGACCTTGAACTTCTACTTGACTTACCTCAGAGTGGAGCCAGCTGACCTCGAGCTTCTCGCCAAGA
ATTGCAAGTCACTAATTTCGTTGAAGATTAGCGACTGCGACGTTTCAGATTTGATTGGATTTTTCCAAATAGCTACATGTTTGCAAGAATTTGCTGGAGC
GGAAATCAGTGAGCAAAAGTATGGAAATGTTAAGCTTCCTTCAAAGCTTTGCTCCTTCGGACTTACCTTCATGGGGACAAATGAGATGCACATAATCTTT
CCTTTTTCTGCTGTACTCAAGAAGCTGGATTTGCAGTACAGTTTTCTCACCACTGAAGATCATTGCCAGCTCATTGCAAAATGTCCAAACTTACTAGTCC
TTGCGGTGAGGAATGTGATTGGGGATAGAGGACTGGGGGTTGTCGGAGACACATGCAAGAAGCTACAAAGGCTCAGAGTTGAGCGAGGGGAAGATGACCC
TGGCATGCAAGAAGAGGAAGGCGGAGTTTCTCAAGTAGGCCTAACAGCCATAGCCGTAGGTTGCCGTGAGCTGGAAAACATAGCTGCCTATGTGTCTGAT
ATCACAAATGGGGCCCTGGAATCCATCGGAACGTTCTGCAAAAATCTCCATGACTTTCGCCTTGTCCTGCTTGACAAACAAGAGACGATAACAGATTTGC
CGCTGGACAACGGTGCCCGCGCGCTGCTCAGGGGCTGCACCAAGCTTCGGAGGTTCGCTCTATACCTGAGACCAGGGGGGCTTTCAGATGTAGGCCTCGG
CTACATCGGGCAGCACAGTGGAACCATCCAGTACATGCTTCTGGGTAACGTCGGGCAGACGGATGGTGGATTGATCAGTTTCGCAGCCGGGTGCCGGAAC
CTGCGGAAGCTTGAACTGAGGAGCTGTTGCTTCAGCGAGCGGGCTTTGGCCCTCGCCATACGGCAAATGCCTTCCCTGAGGTATGTGTGGGTGCAGGGCT
ACAGGGCCTCTCAGACCGGCCGCGACCTCATGCTCATGGCGCGGCCCTTCTGGAACATCGAGTTTACGCCTCCCAGCACGGAGACCGCGGGCCGGCTGAT
GGAAGATGGGGAGCCCTGCGTTGATAGGCAAGCTCAGGTGCTGGCGTACTACTCCCTTTCTGGGAAGAGGTCCGACTACCCGCAGTCTGTTGTTCCTCTG
TATCCTGCGTGACTGTAAATACATTAAGCCGGTATGGTGTCTCTCTGGGACGGCCCCTGGCTGGCCCTCTGCGCTTCTCGGGCAATAAGGATGTTTGTAT
GTGGGTATTGTATGGATCTGGTAGGTTTTCTAGCTGCTGTGTACTGGAATAAGAGCATTGGTATTTTTGCCTGGTACTCCTATCTAATCTTAGGAAGATG
TATACTACTGTACTAAGGAACATTGTGCGAGTGCAACTGTGACACTATTGCGCTTGCTTCGCAGGCATAAAAAAAAAA
page-top