Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32665  (registered. 2012)
Contig Information
Length 721 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 8
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 7
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 12
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig32665
TTTTTTTTTTGACGGTCAAAGTCTGCCATTGGGTTAACAGCAAAAAGGACACCCTTTTTCGTCTTGTACATATAAGACCAACACGAGTCAACAATATCTC
AATCATGCAGTTGGTCAGCCAATAAACAATATAGTTCCCCGGGTTTGCTAGTTTACAAGACATATTTTTTTCAGTGAACTTTCCTCAGCAAAAGTTTGTC
ATCGCCACATATATTAGTGTGGTTGCAAAATAGTACTATTTATTACACAGCTATTTTTCTTTGTGTAGCATGCATGCAATCGGCGTCAACTTGCACTGAA
TCGTGGCGTCAACCACATCAATCAGCTCGATCGTTGCCACATAAAATAATTCTAGAACTCGTAATCATATCGCAACGTCGCCATCGCTGCATATAACGGT
GATTCATGTGTTGGCCACAACTTGCATGGTCTTGCGGCGTGGAGTCGGCGGGGATGTCGCCTGTGGAGGTGGTTCAGGAACCGTTCTGCAGCCATAATGG
ATCTTGCACGGCTGTCCGGTGTAGGGTCCCCCATGCTCCGCGGAATGGGGAACCGGCGACGGAGGGGGCTTTAGTGGCCCATGGAGTCCGTCGGGAACAA
CTCGGATTGCCGTCGTTGAGCGTGGCGTGAAACAGCAGATGATTGCCAGCACCGCCACCGCGAGAGCGAGGGAGGAAGGACGCGCCATGATCCTCACGTA
GCCAGCTTCTCACTGCCCCGG
page-top