Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32607  (registered. 2012)
Contig Information
Length 884 bp
Clones alternative view 762 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 265
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 67
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 158
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 18
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 98
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 48
WH_XV Leaves, plant was grown at constant 23 57
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 17
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 25
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|213512148|ref|NP_001134061.1|| Photosystem II 10 kDa polypeptide, chloroplast [Salmo salar]"
Score 246
Evalue 2.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32607
TTTTTTTTTTGATAGTACCAGGCCTTCTTTATCTTCATCTTTACTTATTACAGAATTAAATTCTGTGAACATTCAAGTGCCATTGTAGAACTTGGTAACA
TTTGCGAGAGAGCTCATGCGCTTGCACTGAAAACTTAATCACGCTTGCACCATGCTTTTTTTTTTTAGTAATTAATTGTCGGTATTATTGACTGCGGCCT
GCGGGTACTGATATTTACATCCAGTTACATATGTCGTTGCGGTTGTAACCCGTACAGTACACATCGTTTGATTCATATTTTGGTTTGCCGCACAGGCTTC
AAGAAGCCAAGGCACTAGTATTGTAGACAAGCAGAGCACCGCCCAGCAGAATTCCAGCAAGAGTGATTGCCCAGAGAAACAGCCCTGTCTTTCCTCCAAC
ATAAACGTCACCACTTGGGGACCATTCTTCTGGTGTATATATTGGGCTGTACCCATCAACATTTGCTCCATACTTGTCGGCAAACTGGTAGACACCCTTC
CCCTTGGCTACCCTTCCAGACGCATCGACGCCTTCCTTGAACTCCACTCCACCACCAGGCCCGTAGGGTTGGGCAGTCTGGACCTTCTTCGCCTTCTTGC
TGGCTACTATGAGCAGCGATGGCCTCGCCGATGGTCGCAAACCTCGGAGTTTCGCTCGTTCTAACAGTGGAGAGGGAGATGGCTTCGTCAGAACCATAGA
CGCCATGACAGAGGCAGACATGTTTGTGCTCACTGGATCACCCTCTTCCGGGTAAGTGCTATTGGGAAGTGTGAAGGATCTGATAATGATTTCGAGCGGG
CTACTGCAGTAGNTGCTTCAGTTGTTGATGAATTGCATGCTAGGAAGNATGAGCTAGTACATAAAAGTTATACTGAAATTATTG
page-top