Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32578  (registered. 2012)
Contig Information
Length 907 bp
Clones alternative view 101 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 8
Wh_h Spike at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Wh_EM Dormant seed with water absorption 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 3
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 7
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_SP 4
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|63079015|gb|AAY29571.1|| immature spike ubiquitin-conjugating enzyme 2 [Triticum aestivum]
Score 311
Evalue 5.00E-83
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32578
CCTACAGCCAATCCGGTACCAAAAAATAGAGCAGTAACATAACCAGAGAGGAGACGAACATATGCGTGCAACTGAGCAAAAGCACGCAAAGTGGCCAACT
GGCCACAGAACAAACATTTCCATCCACAGGCACCATATAGCGAATGGGAGAACCAACACTACCGTAGTTATAACGAGAAGCATATGTCAATTTCATTATG
GACTTTGGCAATGATAGGTTGATGTTTTGACTACGACGCGATCCTACATGGATCAGGGAGACACACGCGACCGACAAGTAATCAAAGAAAATAATGGCCC
AGAGATAGTTTCTCGGGACAGTGACACAATCTTCTGCATGCAAGCAGTGGATACGAGCATGGGCTTCGTATCATCCCATGGCATACTTCTGCGTCCAGCT
GCGGGCTGTCGTCTCATACTTGGACCGATCCGTCTTGTACATGTGGGCAATCTCGGGGACGAGAGGGTCGTCCGGGTTAGGGTCGGTAAGCAGCGAGCAG
ATTGAAAGCAGAACCTTAGAGATTGTCAAAGCAGGACTCCATTGCTCCTTCAGAATGTCAAGGCATATGCTTCCATTGCTATTGATGTTCGGATGGAAGA
CCTTTGTCTTGAACGATACCTTCGGCGGCTTGAAGGGGTAGTCCGGGGGGAAATGGATATTCACTAAGAAAACACCTCCAGCATAGGGACTATCAGGAGG
ACCCATAATGGTTGCCTGCCAATGGAACATATCCTCACCAGAAGGACCTGCACTGCATGATGTCGGAGGATCTTTCTGCAAGTCCTTCAGTTCCTTCAGG
ATACGTTTTGAAGCCATGATAAGCTCCTTTTCTTCGCGGCGGCCACGAGAGGTCGGGATGGAGAGAGAGGCCCTCGCTCCTTTTCCGCTCGGGGTCTTTC
CTCGTGC
page-top