Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32531  (registered. 2012)
Contig Information
Length 797 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XE Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|14861035|gb|AAK72401.1|| Mg-chelatase subunit XANTHA-F [Hordeum vulgare subsp. vulgare]
Score 379
Evalue 2.00E-103
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32531
GTAGATGACATGTGACAGCAAAGTACCAAAAAAGAACTTCTACTCATGCTTCCTTTTTACATTCACAACGAACCACCCTCTTTGTTAAAGGTCTGTATGG
CATGTTACAACTTTTATAAATCACAAATTATACAAGTTTCGACTCAGCAAGGCAGAAGAATATTTCTTCTTGGTCAAATGCTGGAACTGGTTGATCAGTG
AAATGAGTTCACCGGTCAATTCCTTCGATCTTGTCTTCAACCTCCGAGTAGAGCTCCCTGAGCCTTTCCAAGTTATCCTCTGATGTCTCCCAGTAGCCCC
TGCCATTTGCTTCTAGGAAGGTTTGAAGCAGTTTCCTGAACGAATTGGGGTTGGTGTCCATCAGCCTCTTCCTCATCTCTTCATCTTCAATGAATGTGGT
ATTTGCTTCCTCGTAAACCCAGTTGTCCACCTGCCCGGATGTTGCACTCCATCCAACAGTATTTGTCAGCCGCTTCTCGATCTCTCTAACTCCCTCATAG
CCACTCTTCATCATCCCCTCGTACCACCTAGGGTTCAGTAGCTTTGTCCTTGCATCAAGACGCACCGTCTCCGACAATGTCCGCACCTGTGCATTTGCCG
TGGTTGTGTCTGCTATGTACGATGAAGGTGCCCGCCCATCCTTCCGCAGCCCTTGCACCAGCTTCGTCGGGTCTGANNNGAAGTAGTGGCTGACATCCGT
CAGTGAGATCTCCGACGNNNCCAGGTTTTGGAATGTGGCATCTGCTGTTGCTAGAGCAAGCTNNNNNGTCTTGCGTTTCTCTAGCATGCCTACCCCT
page-top