Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32528  (registered. 2012)
Contig Information
Length 791 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XV Leaves, plant was grown at constant 23Ž 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|293335619|ref|NP_001168798.1|| hypothetical protein LOC100382597 [Zea mays]
Score 247
Evalue 9.00E-64
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32528
ATGACCATGGCTGCAGCCTTAGTTGGTACAGAATAAAGCATGCATAACACACGCACACACACCTCACGTTACGATAGTAGTTTGGGCGGTTACACTGGAT
TTCCACTACATTCGCTAATCTCACGATCTCTAGCGTGGCCATCTTACACGCCCTCGTTTGGGCCAACAAATATATGTACAAATGAAAGAATATTGTACAA
GTCAGCCCCCAAGAAGGCCCACCGGCAGCGGTCAGTGACTCGGGCATTGCAACTGGCTGAGCCTTGCGTTGAGGGCTTCAATGTATGAGCGCAGTCGGTG
TCGGTCAGATCTAGTCAGGGACAAAGGCGGGTTGAGGGCGAGCGATGGTGCCTCGATCAGGAGAAAACGCAGCAAGCATATTGCCTTTGTATACCGCGAC
ATGGCCACTGCTGCTTTCCCCATCATCTCTACAACACCACCATGCCTTCCATATTCTAGTGCAAATTGAAATATTAATTCAACAGCGTCGGGCATCGCTG
TAGCATCAGGTATCTGCCCTACAGTGCTTGCAAGTTCTTCAGCATGTTCAACTTCAGTGAGAAACTGCCTCTCAATCTGTGTGCATTCTTCATCAGCCAT
TTGAGAGTTTGCAAGCAATTGGAGAACGTCAGTATCAAGCCCCTTCATAGTGATATCATGTGAGGGACTCTCTCTGGCAGCTGAAGCCGCATAGNNNTTG
CATATGTGAATTGCTTGCTTCCAGGTCGCAAGAATAATTAGCTGGATCGAGAATGCCTCTAAGTGCCTGCCACCTTTTATCTCTTCTTTGA
page-top