Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32522  (registered. 2012)
Contig Information
Length 1713 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_EM Dormant seed with water absorption 3
Wh_VABA Shoot with ABA treatment 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|52076192|dbj|BAD44846.1|| PEX14 -like [Oryza sativa Japonica Group]
Score 551
Evalue 1.00E-154
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32522
TTTTCTTACATACAGGTAGAAAATATAAGTGATTCCGTATACATGGTGCCGTCAAGTGAATCACACAAGTATCTAATCCATTTTTTCTTATACACGTGCT
GCTAATTACAACCATCATATGCAGTTTCCAATACCTAATTAACAGTGCATAGATAATTAGATATGTGAACCGCACACAACACGGAAAATCGAATGAGTTG
CTCTCGTCAAAATCAGGCGGCTCCAGGCCCTTCTCCATTCTCACCGTTGGCCGCGCCGGCCATGGTGCCCACGGCAGCGCTGCTACTAGGCGACTCGTCA
CTGGTGACAGCGGATGATACACCGTCCATCTGCTCATTTACGGCAGAGTCTGCCGGTCTAGGAGCATCGGCTGAGCTTGCTGCTGGCTGTGGCTCTTGTC
TTGGAAGGGACCTTGGCTGCCGAATGGCGGCCGCGGCCTCTGGCATGGCGACCCCTGGTGGCTGTGGGGGAACCCAGTGGCGCTGGAACGGGCTTTCCTG
TGCAACTGGTGTCGGTGCTGGTGCTGGCGCCGGTGCTGGTACCGCTACCGGAGCTGGTGCCGGTGCTGGAGCATCAACGGCGTTGCTGCCCCCAGGGTAG
TACGGAGGAGAACCGTAGTAGCCCTCCCGAGTACCAGGGTTCGATCTGTCATAGCCCATCTGCGGCTGGAACCCGTACCCAGCCCTCGGCACCCGCTGAT
CAACATAAGATCTTGGAAATGATCCCGCTGTAGGTTCTGCAGGTAATGGCATGAACGGTTGCCTCCCTGAGTCAAAATCACCATTTGGCGTCGTTGTGTA
CATGTTGGTTTGCTGGGAAGTTCTCCATGAATTAGTAGTTGGCCCATTCCATGGTCCAGGTTGAGCATGCTCTTCCAACATATTGTACTGCGAAAACCGA
TTCTCCCTTGTATGATGTAAGGTCTCGCTCAAGGATTTCAACACCTCTGCCTGAGAATCCAATGCTTCTGTTAACTTTACAAGTATCTTCTTATCTTCTT
CCTTTGAAGCCAGCAATTCTTGGTTTGTTTTAGCAATAGCAGAAAAGGCTGATGAGGAAGCTTCCATAGCCTCTTTAATTTCATCATAAAGCTTGGATTT
CAGATCGTTGTCCGCATTTTCATCTCCTTCAGAAACGACTCTACGGGTCCAAGATTTTAGCCTAGGCAGGAACAATTTCTTGATGATGACAACTGAACTA
GCTCCAACTCCAAGGAAAATACCAGCACCAAGGAGTGTATGATACCAGCTAAATTGTGTCTGTGTTTGTGGGACTATATGACCAGTGGCGACAGAGCCAG
TTGGCGCTTGTGGCGTCTGAACTGATGCGTAAGGTTGCACCCCCGCAGATTGATTTGGATTGCTTGCTTGTTGCGAACCAACAGCCGCAGCATCCGTACT
GCTTGTCGGCGGATCAGGAACCCGGCGGAAGGCCTCGTCGATTTCCTCCTTGGTGAGCCCTTTCTTCTCCAGGAAAGAGTACCTGTAGGACACCGGAGAA
CCCTTCACCTTCGGATGCGCGAGGAAATTGACGGCGTTCTGCACGTAATCCTCCCGCACTGCCTGTGGGGCTTGGAGTACCAGATTTTCCGAGGATCCGC
CTCCGCCGGAACCATCTTGCGGCGAGGAGCTGGGCGGCTGCGCGGCCATCGGGGGTGTTCACGGCCGCATCAACCACGGAATCTCGCCGACGACAGGCGG
CGGCGGCGGCGGC
page-top