Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32520  (registered. 2012)
Contig Information
Length 776 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242067066|ref|XP_002454822.1|| hypothetical protein SORBIDRAFT_04g038090 [Sorghum bicolor]
Score 350
Evalue 7.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32520
GAGTGTGCGGTTCAGTTCATCATCTGATTCAGTCACAAATTAATCATCCATCCATCGACGGGAAGGTACACGTAAAGCTGCTTAATTAGGATCCGGTGAA
TCAAGGGCCAGCATACAGACATGCTTCAGCTAGCAGCTAGTCATTTGCAGAAGCAGCGTCTGTGCGAGGAAGCCGGTACTCCTCCGGCTGGAGGGCCACC
GCGAAATCCGGCAGCGCCGGCACCGTCTCGTGTGTCCTGTCAGCATTGCTGTAGAGGTCCTTGTTGATGCGAACCTTGCAGTTGGAGTCCTTGTGGATCT
TGTCGTGGAGGTACTTCATCGATCCCCATAGGGTCGGGCTCCTTGAAAAGGGGGATGCGGTGTGGAAGGCCTCGCAGACGGCCCTGCTCTCCCTCAGGGA
CTCCTCTGCGGACTGCAGCGCTGCCACAGCCGCCCGGTGAGACTTCTCGGTGTTGCCCTCGTCGAGGATCAGCCCGTGGTAGTAGTATGCCGCAGCTTTT
GCTTCCATGTGCTTCCACTTGACAAAGAGCCTGTGCTTTTCGCCCCAGCCGTCGAGCAGAGGTATGTCCGCGATGCTTTCATGTGCCTGCTGCCAGCACT
TAACCATCTCACATGCCAGCCTCCTTTTGACAGCCAGGGTAGCCTTTGGACTGTCAATTGCCAACCCAAGTTGAACATCAATTGCCTGACCGAGTGCTTG
CATGCAGGTAGCTTTCAGGACCCCTTCAGACAGGTCCACGGGAAGACCTTTCCTCTTTTCGGGCGACATCCTGGGA
page-top