Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32519  (registered. 2012)
Contig Information
Length 1078 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XV Leaves, plant was grown at constant 23℃ 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115459620|ref|NP_001053410.1|| Os04g0533500 [Oryza sativa (japonica cultivar-group)]
Score 416
Evalue 2.00E-114
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32519
CTCGGCTTTCCTCTCGCTCGCCGCTCGCTGCTCTCTGCTCTCTAGGCCGTGCGCAGGGCACACGCTTCCCTCACTCCCCCGCCTTTCGTCGTACCTCGAT
CGAGGCGAGCTGATAGGGAGTGAGCTACCCCTACGGAAGAAGGAAGAAGGAAGGCACACAAGTTCGTGTGCAGCAGGGCGAGATGGCGGGCGCGCTGGGC
GTGAAGGCGACGCCGTTCACCTACGCGGCGCACGCGCTGGGCGCGGCGGCGGCGGCCATGGTGCTCGTCTGGTGCATCCACTTCCGCGGCGGCCTCGCCT
TCGAGGCGGTCAACAAGAACCTCATCTTCAACGTCCACCCTGTTCTTATGCTCATCGGCTTCATTATCCTTGGCAGTGAAGCCATCATGGTCTACAAGGT
ATTTCCGGGACTGAGCCACGACACGGCCAAGCTGACCCACCTGATCCTCCACGCGATCGCCATCGTCCTCGGCGCCGTCGGGATCTACTGCGCCTTCAAG
TTCCACAACGAGAGCGGGATCGCCAACCTCTACAGCCTGCACTCCTGGCTCGGGATCGGAGCCATTTCTCTCTACGGAATCCAGTGGATATTTGGGTTCG
TGACGTTCTTCTTTCCCGGGGCGGCGCCGGACGTGAGGCGCGGGGCTCTGCCGTGGCACGCGCTGTTCGGGCTCTTCGTCTACGTGCTCACGCTGGCGAC
GGCGGAGCTCGGGTTCCTGGAGAAGATGACGTTCCTGCAGAGCTCCGGGCTCGACAAGTACGGCGCGGAGGCGCTCCTGGTCAACTTCACGGCCCTCGTC
GTCGTGCTCTTCGGCGCCGCCGTGGTCGTCGCTGCCGTCGCTCCCGCGGCTAAGGTGGAGGAGCCGGAGGGATATGCTCCGATCCCAGTCATCGGTTAGT
AGCATCCTAGTACGTGGCTACGTGCTACTGATCGTCGAAAGTCCAGAAGCGAGACCGCGTGTGCGATTGGTTCCACGAGATCGGGTGTAAGCACAGAACT
CACGTCTGATTTGTGTGTATCAGCTGAACCGTACGATTTGATTACTGAAAACTGCAGTGGTACCTTTGAAAAAAAAAA
page-top