Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32518  (registered. 2012)
Contig Information
Length 1473 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242056981|ref|XP_002457636.1|| hypothetical protein SORBIDRAFT_03g010860 [Sorghum bicolor]
Score 841
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32518
ATTGTGCAAGTGTAAATTTCAGCTTCTGTTTCATCTGCTTCGAAATACACTACTCCCTCAACTAAATGGGGGGTTAATATTATCTAAACGATGATATCAC
GAGCTCTCAGTTGTATCCATCTTCGAAGCTTCCTCGACGCCCTTGAAGGCTACACGCAGCTTCCTCAGCGATGACACTTTCTTCCCATTGCTCTCCGCCA
TACCACTAACATGCACAGTAGCAAATGGGGTTCCTTTAAGGAGCTCAAACATGGGGATGCTCAGGTTTGGCCGTGTCATCTGCTCAAGAACTTCTGGCGA
CTGCATGTACAGATTGTTGCCTCCGTGCGTTACGCTAGCTTTTGACATCAGCAGTTTGGGGTGCTCCTCAAGCATCTTGATGAACTCCGAAAGTGTCGAT
GACGTATCCAGCTCAATAAGGGTACCAGGCCCACATACAAGGCAATCTGTATCTCTAACAAACTCTGTGACTTTAATATGAGTTCCTACAAGACCATTGT
ACGTGAGATAATTTGACACGCTTTTGCTGCAGCCAGAGACGAGCTTCAAAGCTTCAAGTGCACACGCAGCAGAAATAATTGCATTCGTTGAAGCAATAGC
TGGGATGATATTCTTGACAACACCCTGAGTCAAAGAATACGTAACTCCGGAAATACCAAAAAGTTCTGCTCTCTTTAAAGCCTCTGAATAAATCCACTGC
ATATGTTCTGTATCATCAGCATCAAAAGGTTTTCCACTGTGAACCTCGTCCCATTTGATCAAATGAGCATACTCAATGCAATGAGCTGCAGTTCTTGGAG
TCTCAGCAAGGGTACATAAGGGAAACTTGACCTGGGGAGGAAAAAGCCATATGTTGCATTCAAAGCAAGGCGTCATCCCTGGTATAATGACTCTAGCATG
ACCTTTGAAACCTTCTGTCCCACCATCTACCATAGGTTTAACTGTCTCCTGGACTGGTTTGTCGTCTGAGTCATACTCTAAGAAACCACAAGCCACAGAA
TTGATGTAGCTTCGAGCTTCAATTGAGTCCAGACCAAGAACAATTATTTGGAACTGATTATAGAACTCTAGCTCTTTATCTTCAATCCTACAAAAATGGG
GCACAATGTTCACTCCACTAACTCGCTCCATAACCCTCTTCGCAGCTACTTCAGCCTTGGGCTTCCCAACGTCTTGAATCCTGAAGAGGAACTGGCGGTT
GAGGTTGGAGACGTCGATGGTGTCCATGTCGATGACGTGCAGGTTCTTGAACCCGGAGAGGGCGAGGTCCTTGAGGAGCTCGCAGCCCAGCCCGCCCGCC
CCCACCACCAGCACCTCGACGACGCTCCCAATAAGGTCTCGCAGCCCGGGGCTGGGATCGAAGGTGGAGTGGACGAGGTTGCCGGGGCGGGAGAGGAGCA
TGTCCAGGTCTCTCCACCTTTCGGGCTCCGTTGGCGGCGCCGCCGCCGCGTCGGGGGAAGCCATCTCGCCTGC
page-top