Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32517  (registered. 2012)
Contig Information
Length 993 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|60100238|gb|AAX13288.1|| senescence-associated protein [Triticum aestivum]
Score 328
Evalue 6.00E-88
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32517
TGCATCGTAGCTAGTATATATATTGGCTTGAACTCATCGTCCCAAGAAGGAACAGGAGCGAGGACCGGACTGGAGATAATGGCATCCGAGTTCTCCTTTG
CCCGAGGCGTCTCCCTCCCCGCCGCCGCGCACTGGCCGCCCCTCGCCTTCACCTCCTACAGGCTGCGGCACAGTGCGGCGTGCACCAGGGCGAATCCTCG
GGTCGTGGCGGCGGCGAGGGCGGTCTCAGTGGCCGCCGCCAGGAGGATGCCCGGCTCAGTCAGATACGGCGGCGCCAGGGTAGCGGCGTTGCGGGCTGAG
GAGGCCGAGGTGGCCGTGCCACCGTCGGTGTCGGTGCGCGTCGCCTACGAGCTGCAGCTGGCCGGTCACCGCTACCTCGATGTCAGAACGGAGGGCGAGT
TCGGTGGCGTGCATCCGGCAGGAGCGGTGAACGTCCCCTACATGTATAGCACCGGCTCAGGAATGGCCAAGAACCCGCACTTTCTCGAGCAAGTGTCGGC
GATCTTCGGCAGGGACGACGAGATCATCATCGGATGCCAAAGTGGCAAGAGATCTCTCATGGCGGCAGCCGAACTCTGCTCCTCTGGCTTCACTGCCGTG
ACCGACATCGCCGGAGGGTTCTCGACTTGGAGGGAGAACGGACTGCCGGTCAATGGACGCGGGCTTCTATAAATGTGGTTGAAACATCATAATTTGTCTT
AGCATGCTCCGAGACACCACATCAGTGCACTGAATAAGCAAAATGGAGTTTGATATGATCTACTCCTCCGTACCAGAATACTTGTAGCTGGGGAAGCTAA
TACAAGTTCCCCCAACTACAAGTATTTCGGTATAGAGGTAGTATAGGATGTATGTGCTATATTAATGTTAGAATTTCCGTTCTTCACCTGACCTCCTGTA
AACTGGCCCATTACAAAATAACACATGTATGCTACGGTATCTGCAAAACGGAACACCAAAATTACATAATAACATGTTTACTGATCGTTCGGC
page-top