Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32516  (registered. 2012)
Contig Information
Length 863 bp
Clones alternative view 32 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 10
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 7
WH_XV Leaves, plant was grown at constant 23 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1657859|gb|AAB18209.1|| chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 537
Evalue 7.00E-151
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32516
CATGATAGTACAACTCAGGCCACAGGAGAACATGCCTCATTGCGAGCACAGTCCCAAGACACCTTACTTGCCGGGGACAAAGTTGGTGGCGAATGCCCAT
GCATTGTTGTTGACGGGGTCGGCGATGTGGTCAGCGAGGTTCTCAAGTGGGCCCTTGCCCGTGACGATAGCTTGGACAAAGAAGCCAAACATTGAGAACA
TGGCAAGGCGACCGTTCTTGATCTCCTTCACCTTGAGCTCGGCGAATGCCTCAGGGTCTTCGGCCAAGCCAAGAGGGTCGAAGCTACCGCCTGGGTAGAG
TGGGTCAACGATCTCACCGAGTGGGCCGCCGGCAACACGGTACCCCTCGACGGCACCCATGAGCACGACCTGGCATGCCCAAATAGCTAGGATGCTTTGT
GCGTGCACTAGGTTGGGGTTGCCGAGGTAGTCGAGACCACCCTCACTAAAGATCTGGGAGCCGGCCTTGAACCAAACGGCCTCGCCAAACTTGACGCCGT
TGCGGGCGAGCAACTCAGGGAAGACACAACCAAGTGCCCCAAGCATGGCCCAGCGACAGTGGATCACCTCCAGCTCCCGGTTCTTGGAGAAGGTCTCCGG
GTCAGCCGAAAGTCCAGCAGTGTCCCACCCATAGTCGCCAGGGAACTCACCGGTCAGGTAGCTCGGAGGCTCACCGGAGAGTGGGCCGAGGTAGAGCACA
CGGTCAGCACCGTACCATGGGCCGCCGGAGGAAACCTGCTTTGCCTTTGCTGCGGTCTTGCGCATGGTGACGCGGGCCTCGCCCAAGAGAGCCAAAGATG
GTACATTCTTCACCGCCTTGCCGGCAAAGGTCGAGGAGGAGAGGGACATGGTGGCTGCCGCCA
page-top