Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32515  (registered. 2012)
Contig Information
Length 755 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 3
Wh_PCDAM Anther at meiosis 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XN Leaves, plant was grown at constant 23Ž 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig32515
CCGTCGCCTCCTTGCCACAGATATCGTGCACGGTCTGAACGAGGCAAGCAGCATAGAAAGCGAAACAAGGCCAGTCGAACCCTAGATTCCGCCGCCGCCG
CCACCGCCGCCACCGCCGCCGCCACCAATAAGCCCGAGCGTGTATAACGTGATGGCGCTGCGATCGCTTATTCGAAAGATGCCGGCCGTTGGTCTCAGAT
CGACGCCGATGCCCCCCCGTATGGGGCCCGTCCACGCGCTCTCGACGGCGGCTGGTTCTCGGATTATGTCCGATGGTGCTCCCGGAATAAATGGCCGAGC
GAAGATTTATTCCGAAGATGAGATAGCTGAACGACGGGAGGCAATAAAACGCCTGCACGCGGAGATCGAGAAGGACCGTGCGGTGTCTGAAAGGTATCTA
GCTGAGCACAGGAATGTAATGGAGATGCTGGAACAACAGAGTGCTGCAGGAGAAGCTGCCTATAATGCAGCTATGAGGGATATTAGTGAAGCCCGTGTAA
GTTGTATGAAAACACTGAAGAACGTGGCTACGGCATGCGATGTTGTTGCGGTTGCCTGCCCTATGCTGATTGTCCTTATGATGATCACTACATAGTAACT
TACTGTATGTTTGTTCGGTGCTATCATCGAACTACCTCCCTTCTTATTTATTAGGCCTGCATGTATACCTAGATTAATATCCCAAATGATAGGGATTTGC
TCTTCTAGAATGCATATATGTCAGAGTGTTGAATGCAGTAAAGTATAATGGTCTA
page-top