Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32514  (registered. 2012)
Contig Information
Length 1621 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222631641|gb|EEE63773.1|| hypothetical protein OsJ_18594 [Oryza sativa Japonica Group]
Score 695
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32514
GATCATATGATGATTGGCAGAAGGAAGTGCTTGCGAGGCTTGACGCTGCATTGGTTGGTACACAGTTAGAACCATTGGCTGCAACTACAGCGTTATGCCT
GAGCTATGAACCAGAATGCCGCCCAGAGATTGCTGATGTTTGGAAATGTATCAGAGGCTCACAGATGAAACCTGGTGCTGATGCTTTGGCTCCTGATGAT
GATATTGTAGCTCAGAAAAGTTTTAGGTGTTTGCTCCTCGGGGAGTTGTCCTCAATGTGCTCCGCCCAAGCTGTTGAGTCAGATGAAATAGTGCAGCCCT
CTCAAGATTCTGATGACAAAAATTCAACTCCAGATGATGAAAGCAATTGTGGTTGCTCAAACGATGAGTCTGTTTGCACAGCAGGAACAGATGAGCCACA
GCGTAATGGAGTGTTTAAATCTTCAACTCTGCTTGCTCACCGTGACTGCGTCACAGGATTAGCCATTGGAGGGGGATTTTTGTTTAGTTCTTCCTACGAC
AAAACAATCAATGTATGGTCACTGCAGGACTTCTCTCATGTGCAGACTTTAAAGGGTCATGAGCACAAAATCACAGCAATTGTTGTTGTTGACAATGATA
ACCAGTCTCTTTGTATAAGTGGAGACAGTGGCAGTGGAATTTTTGTCTGGCGTGTTGGTACCTCTCTCAAGCAAGAACCATTAAATAAATGGTATGAAAC
TAATGATTGGATCTACCGGGGTGTCCACTGCTTGGCTGTGTCTGGAACTGGTTATCTTTATACTGGCAGTAGAGACAAATCTATTAAAGCTTGGTCTCTG
GAGGATTATTCACTTGGATGCACTATGACAGGCCACAAGTCAACCGTGTCTTGCCTTGCAGTTGCTAGCGGTATTCTTTACAGTGGAAGTTGGGATGGTA
GTATCCGATCATGGTGGCTTACTGATCACAGCCCGTTGTCTGTACTTGAAGATGATGCACCGGGAAGCATAGCCCCTGTGTTGTCAATTTCAACAGAAGC
TAATTTTGTTGTTTCATCATATGAAAATGGCTGTTTGAAGATTTGGAAGGATGATGTCCTCGTTAAGTCAGAGAAACTTCAAAATGCTTCTATTTACGCT
GTTAAATTGAACGGTAAATGGCTATATACCGGTGGATTGAATAAAGCCATAAATATTCAGGAGTTATTAGAAGACGAGTCAGAGTTGGAAATCAGAGATG
TCGCTTCCATCTCTTGTGATTCAATTGTAACTTCAATATTGTACTGGAATGAAAAGCTGATAGTAGGACTCTCTAACAGGGAAATTAAGGTTTACGACAA
GGGTTCTTAGACCAAATCAGGAGTCGCTTACCATTTGTTACTCCATGGCCCTATATATATTGTGAATAGCTCACTCTACAGCGAGCGTGATGAAGAAATA
CACATGGAAACATAACTTATCACCATTCTGATGAACTATGATACACCTGTATGGTAAAAGTTTGAAGGGAAATGCAAGCTAGATTAGGTATTTGTAACTT
AAACAATTAGCCGCTATAGGCATAATTATCTGTTATAATCCGCTATAGGCAGGGCATAGTGTTTGGGTGTGCTACTTTCTAAAATTGCTAAAGATTTTGG
GCTGAACCTGAATGCTATATG
page-top