Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32513  (registered. 2012)
Contig Information
Length 831 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|18958|emb|CAA44777.1|| Precursor of CP29, core chlorophyll a/b binding (CAB) protein of"
Score 295
Evalue 3.00E-78
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32513
TTATCAAGCACAAGTTTCCAGCAAGAAAATAAAAAATCAAGCACAAGCTGAAGCAGTGGTCCGATACTCCCATCAGAAATCAGAACGATCATGTTTCTTC
TGCCCTTGATAATTTACACGTACGGCACATTCGTACTCTCATACTTTTCCCCGGTAAAATTCACACAGCACATGATGCTGCATCGCGCGCATCGCACGCA
GCTGATCCATCAACAGCCGACGGCGGCGGACGGGCAATCAACGGCCAGCTCACAGGCTGGGCACCCTCTCGGCGGCGCCGGAGATGACGGTGAGCAGGTT
GTTGCCGAAGGGGTCGCTGAGGTGCGCGCACAGGTTCTCAAAGGGGCCCTCGCCGGTGACGTAGGCCTGGATGAAGAAGCCCAGCATGGAGAACATGGCC
AGCCGTCCGTTCTTGAACCAAACGGCCTCGGGACCGCAGTTTGCGCCGAACTTGTTGAGCGCCTCGGGGATGATGAATCCGGCGGCGCCGAGCATGGCCC
ACCTGGCATGGATGAGCTCAAAGGCCTGGTACTTGGCGAAGTCCTCTGGCTTCTTGCCCAGACCAAAAGGATCATAGCCGTAGTCTCCGGGAACCTCTCC
GTTGAGGTACTCCGGCACCTCCGACCGGTCAAGGAGTCCGTTGGGCAAGTAGATCCTCCTGTCAGGGCCGTACCACTTGGCGAGCTCGTCGTCGATGCCT
ACGCTCGAGGTGGCCACGGGGGCGGGCTTCGGCTTCGGGGCAGGCTTCTTCTTGAAGCGATCAAAGAGGGAGACGATCTTCTGTGCGCCAGCAGTTGGTG
CCGCTGTGGCGTACCTGGAGGAGCCGGCGAA
page-top