Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32512  (registered. 2012)
Contig Information
Length 655 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115450871|ref|NP_001049036.1|| Os03g0160200 [Oryza sativa (japonica cultivar-group)]
Score 199
Evalue 2.00E-49
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32512
GCAGCGGCAGCCAGATCCGTCCGTCCGGCCGCCCCGCGAGGGTCCATCCGCCGATCCCCCTCGACCCTCTCGCCGCCGGCCGGTGTCTCGTCTGATCGGA
GCGTGCGTGCGCTCGCGTGCGGCGGCGGTTAGGGACGGCGGAGACAAGCGCGGAGTCGATCTGAGAGGGAGGGGCGAACCCCTTCGCGCTCCTGTGGGTT
TCGATCTGTTCGTCGGGTGTAGATCCGGAAGGGCTTGGTTCGATCTGCCACTTACGACTTGGCGCCATGGAGACTCTGGTCATCTCGCAGCAGCGCAGCC
ACCACCACCACTCTGGTCGCCGGAGGAAGCCATCCCCGCACACCTCGTCGCCTCAGCCCATGCGTGGCTACCACGCCTTCAACTGCCGTGCCTTCCACTC
CAGTATCAGCATCGGCATCCTGCCGTCCCCGCCCCCACCCCCACCTCCGCCTGCCCCCCGGGCTCGGACCTACTCCCCGGAGCCCAAGACGCCCAAGCAG
CAGCTGCACAATGGCAAAAAGCGCAGCAGGGCGATTCCTATAACTCCATCAGGATCTCCTCCTTCCCGTCCCGAGCTTTGGGCTGGCCCGGCATACTCCA
ATTCGCCGCCACCCAGCTCGCTGCCTATTCCCAAGTTCTCACTCCACCAGAAGCG
page-top