Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32504  (registered. 2012)
Contig Information
Length 1388 bp
Clones alternative view 106 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 8
WH_XA Root 19
WH_XB Root 13
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|12229949|sp|Q9XHS0.1|RS12_HORVU|RS12_HORVU RecName: Full=40S ribosomal protein S12
Score 281
Evalue 1.00E-73
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32504
GGCGAACAGCCATACCCTTGGGACCTGCTTCAGCCCCAGGATGAGATGAGCCGACATCGAGGTGCCAAACACCGCCGTCGATATGAACTCTTGGGCGGTA
TCAGCCTGTTATCCCCAGAGTACCTTTTATCCGTTGAGCGATGGCCCTTCCATACAGAACCACCGGATCACTAAGACCTACTTTCGTACCTGCTCGACTT
GTGGGTCTCGCAGTTAAGCGCGCTTTTGCCTTTATACTCTACGCGTGATTTCCGACCACGCTGAGCGCACCTTCGTACTCCTCCGTTACTCTTTAGGAGG
AGACCGCCCCAGTCAAACTACCCACCAGACATGGTCCTCGCCCCGGATTACGGGGCAGAGTTAGAACCTCAACATTACCAGGGTGGTATTTCAAGGACGG
CTCCATTGGAACTAGCGTTCCAACTTCAAAGCCTCCCACCTATCCTACACAAGTAAGGTCAAAGTTCAATGTCAAGCTGCAGTAAAGGTTCACGGGGTCT
TTCCGTCTAGCCGCGGGTACACTGCATCTTCACAGCGATTTCGATTTCACTGAGCCTCTGCTGGAGACAGCGCCGCCATCATTATGCCATTCGTGCAGGT
CGGAACTTACCCGACGAGGCGAAAACCCTACCGCCGCCGCTCTCCATTCTCCAAGGTCCCAAGGCTCCAGATCTCCCTCCTTCGCAGCTGCCTCGGTGGC
CTTTGGAGCGCACGAGATGGCGGAAGAAGCCCCGACACCAGTTGTTGCCCCAGTAGAGGCACCTACCCCGGTTCTTGGTGAGCCGATGGACTTGATGACT
GCTCTACAGCTTGTCATGAAGAAGTCAAGTGCTCATGATGGCCTTGTGAAGGGGCTCCGTGAGGCTGCCAAGTCCATTGAGAAGCATGCTGCTCAGCTTT
GTGTGCTGGCTGAGGATTGTGACCAGCCTGATTACGTGAAGCTCGTTAAGGCACTATGCGCTGAGCACAATGTTCACCTGGTTACTGTGCCAAGTGCTAA
AACTCTTGGAGAGTGGGCAGGGCTTTGCAAGATTGACTCTGAGGGCAAGGCAAGGAAGGTTGTGGGCTGCTCTTGCGTTGTTGTCAAGGACTATGGTGAA
GAATCCGAGGGCCTTAACATCGTGCAGGAGTACGTCAAGTCTCACTAGATGAGAATGTTTCATGATGCAAACATTTGGGTTGGGCATTTTTGTCCTCGGT
TTCATTTATGCTTTATTCTTGGGCTTCCTATTGTTCCAACTTTCAAGTGTGAGCCTAGCAGATATCGTCGATTTGGACCTCTGAACCTTTGTTTATCAGG
CAGCTGCTGCCTTCAGCGTAAATCATCAAGAGCTAATAATATATTTCTCTTTGCAATATCACAATTTTGATGTTTTGCTCAAAAAAAA
page-top