Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3250  (registered. 2012)
Contig Information
Length 1160 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 7
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|51242711|gb|AAT99293.1|| beta-expansin TaEXPB2 [Triticum aestivum]
Score 546
Evalue 2.00E-153
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3250
TTTTTTTTTTAAGCAGGAGTGCACACAAACAGTAATAACTTATGGTCTGCTTACACACTGGTACAGTGACAGTGGGCGCGGGAGTGCACATGCAAAAGTG
CCCCTCCTCCATATCCCACCGACGTATTCGACACACACATGCACGACGACGCCTACATGACACCCGATCGACGACCCAACCTTAACCTTAATCAAAAACC
TCCTCGGTAGTACGTACCCATGCAAAACGATCCATGATAGTACAGATACCAAATCAAGCCAATGCATGCCATGATTCCAGATGATGAGCAGCTTCAGCTG
TACTGGACGATGGAGCGGTAGAAGGTGCTGGGCGCCCAGTTGGCCGGGATGACCTTGTCGGCCACCAGCGTCTTGCCGGACTCGTTGGTGATGCGCATGG
AGAAGGGCGCCTGGAGGCGGTGGCCGGAGTCCAGCCGCCAGATGGATCCCCACGACTCGCGCATCGGCGTCCACGTCCCGGAGTTGGCCTCCATGAGGTC
CACCTGCACCACGTCGCCGTCGCCGTCCTCGTACTCCACCAGCACCGCGAAGTACACCGGGTTCGACCCCTGCTCCACGTGGAAGGTCACCTTGAGACCG
GGGAACTCGCACGGCACTCTCTTGAACTGGATGTCGATGATGCCCGAGTGGCGGAGCTTCTCGCTGAGGCCGGGCTTGGCCATGGCGCCGAACGCGGTGC
CGCTCAGGTCGAAGTGGTACTTGGCAACCGGGTAGTAGTTCATGTCGGTGATGACCACCGTCTCCGGGTTGCCGGAGCAGGACTGGTCGTTGGTGCACCG
TATCTGGTAGCAGGAGCCGCACCCCTTGCCGTCCTTGAAGATGGGCTCGTTGCCGCAGGATGTCATGGAGGAGAAGGGGTACTGGTTGGTGTTCTTGAAC
CCGCACGCACCGCCGTCGTCGTCGGGGCCGGCGCCGGTGGGCGCGCCGTACCAGGTGGCCCTGGCGTCCTCCCAGTTGGGGTCGGCGGTGAAGGCGGAGT
CGTTGAAGTTCCCGGCGCCGGCAGAGGCGTAGGTGACGAGGAGGGAGGACAGTGCAACGAGTGCAACGGCCTTGGACGAAAGAGGAGCCATGTCAAAGCA
CCACCGCTTCTTCGAGCTTGTGGGGGTAGTGTACCAGCGCACTGAGCAGGTCGGGCTGGG
page-top