Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32333  (registered. 2012)
Contig Information
Length 724 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_CA 2
WH_SP 3
WH_XA Root 5
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|122044864|sp|P05621.2|H2B2_WHEAT|H2B2_WHEAT RecName: Full=Histone H2B.2
Score 247
Evalue 1.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32333
TTTTTTTTTTCAGAGCAAATACAGTTTAGTTCCACAGAAAAGCAAGACGTACAGAACGGAACCGGATAACAAAAACGAACTTTGCTCCCTTGATTCAAAC
AGCAACATCACTATTTCTTCAAACACACAGGCAGCACAATCCTTACAAATATTGTAACATCGTACTGCCAACTACATACAGAACATCATCATCGATTCGT
TAAAACGACGACGATGAAGCCTAGGATGAGGTGAACTTGGTGACGGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCGCCGGGGAGGACGAGGC
GGACGGAGGTCTGGATCTCCCGGGACGTGATGGTGGGCTTCTTGTTGTACCTCGCCAGCTTGGCGGACTCGCCGGCGAGCTTCTCGAAGATGTCGTTGAT
GAAGGAGTTCATGATGGACATGGCCTTGGAGGAGATGCCCACGTCGGGGTGCACCTGCTTGAGCACCTTGAAGATGTAGATCTTGTACGTCTCCACGCCC
TTCTTGGCCTTGCTGCCCTTCTTCCTGCCCCGCTGCTTCCCCTCGCCGCCGGCCTCCTTGGACGCCGGCGCCCGCTTCTCCGCCTTGGGCTTCTTCCCCG
CCGTCGTCTTCTCGGCCGTGGCCACCGGCTTCTTTTCCGCCGCCTTGGGTGCCATGGGTGCTGGTGGTTGGAGCGTGTGGGAAGATGGGGTTTCGGTGGG
ATGTGAGGGGGGTTGCCCTCGTGC
page-top