Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32297  (registered. 2012)
Contig Information
Length 1098 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218196389|gb|EEC78816.1|| hypothetical protein OsI_19089 [Oryza sativa Indica Group]
Score 541
Evalue 4.00E-152
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32297
CCCGCCGCGTCCGTCGACCCCGACGTCGCGCTCGCATACAAGTTCCCCGAGGCCTCCTTCGCCTACGACGAGAGGGACGTGGCGCTGTACGCGCTCGGCG
TGGGGGCCTGCGGCGCGGACGCCGTCGACGACAAGGAGCTCCACCTCGTGCACCACAGGGACGGCCAGCGCCACATCAAGGCGATTCCTACCTTTGTGTC
TTTATTTCCTAACAAGAACAGCAATGGGCGTGGAATTATTAATGTGCCTGGCATTCACTTCGATGCAAGCCTTCTATTGCACGGTCAACAATACATAGAG
ATCTACAAGCCAATTCCTTCATGTGCCAGTGTTGTAAACAAGGTTAAGGTAGCTGGTTTGCATGACAAAGGGAAAGCAACTATTCTCGAGATCGAAACTA
CCACCAGTCTCAAAGATTCTGGCGAAGTGTTATGTATGAACAGGAGTACTATTTTCTTGCGTGGCGCTGGAGGATTTTCCGACTCTTCCCGGCCATACTC
GTATACGACTTATCCTGCCAACCAGATTTCTCGCATTTCTATTCCAAATTCCACACCTTCTGCGGTGTATGAAGACCAGACGCAACAATCCCAGGCACTC
TTATACAGGTTATCTGGTGATTATAATCCTTTGCATTCAGACCCTATGGTTGCACAGGTTGCAGGGTTCACCCGTCCGATACTGCACGGCCTCTGCACCC
TGGGGTTCGCGGCCCGGGCGGTCATCAAGTCGTTCTGCCACGGGGACCCTGCGGCGGTGCGAAACATCTTTGGCCGGTTTCTGCTGCACGTCTACCCCGG
CGAGACGCTGGTCACCGAGATGTGGGTCGACGGCCAGAGGGTGCAGTACCAGACCAAGGCGAAAGAGCGTGACCGCGCCGTGCTTTCCGGATACGTGCTG
CTCAAACACATCCCCTCATCATTGTAAGTGCTGTGAGGATCATACTTTTTAATCGGTGCTCTTATTAGTTAACTGTGGTGGTCTGAAAAGAGGATGGTTT
CCGTTGTAAACTATATATACTCCTAAGAGATGACACGGTTGTGCAGACGATAAATTCGTATTAGTACTTTTTTTTTGTTCTGTTCATGAAAAAAAAAA
page-top