Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3227  (registered. 2012)
Contig Information
Length 941 bp
Clones alternative view 137 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 4
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 6
Wh_r Root 2
Wh_yd Spikelet at late flowering 14
Wh_SH - 1
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 3
Wh_SHC Shoot grown with cold treatment 3
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 8
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XA Root 6
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XD Root, treated at 50 microM Al for 6h 8
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|729738|sp|P40621.1|HMGL_WHEAT|HMGL_WHEAT RecName: Full=HMG1/2-like protein
Score 314
Evalue 8.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3227
TTTTTTTTTTAACAAGGAACAAATCATACACGCAAATGCATGGCATGGGGCGTTTTTTTTTTAATCTAACATTACCCAGACTGATATTATCACAATGTTA
GCCGGTGACAATGGTGGACGGAAAGAGTAACCATCTAGGTACAAGCAGGGGCACCCCGGCGCTGGGAGCATACACCCTCCAACACAAGGGCACCCCGCCG
GCAGCGGCGCCAACAGGGAGCGCTATCCGTTATAGCAGGACAATGACAAGAAAAAAGGTAAAACAACATCACGATGTGAAGTGAAACTTGGGATAATTCT
AGTGGAGATGGATAGGCTCCTTATGACACCACCGCACACAGCTCAGGTCGCTTCTCGCACAGCAGCTCCCGCATTGTCCGCTTCACTCGTCATCGTCCTC
GTCCTCGTCGCTACCCTCATCGTCATCGTCATCATTGATCTCCGACTTGGACTTGTCGGATTCCTCCTCATCGTCCTCCTCTACCTCCTTGGCCGCCGCC
TTCTTTGGGGCAGCAGCAGCAGCACTCTCGCCCTTGTTGTAGGCGGCAATGGCCTTGTTGTACTCGCCCTTGAGCTTGTTGGCCTTGGCCACGTAGGGGG
CCTTCTCCGATTCGCTCAAGCTCTTCCACCTCTCACCGGCCGCTTTGCCGACGGCGGCGACGGACTTGTTCTTGGGGTTCTTCTGCTTGAACTCCTCGCG
GAACTCGCCCATGAAGACGAAGAAGGCGGAGGGCGCCCTCTTGGGCTTGTTGGGGTCCTTGCCGGCCTTGCCCTTCTTCCCCTTGGCGGCCGGCTTCTCC
GCCCCCTTGCTCTTCACCGCCAACTTGGTGTCGGCCTTGACGGCGCCCTTGGATTTGGCCCCCTTCATGGCTGGTTTCCTGGGTGGGGAGGGGGCGGGCG
GCTGGGGGAGGGAGGGCGCTCCTGGTTTGGGTTGGGGAAAG
page-top