Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3224  (registered. 2012)
Contig Information
Length 833 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222619733|gb|EEE55865.1|| hypothetical protein OsJ_04502 [Oryza sativa Japonica Group]
Score 277
Evalue 1.00E-72
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3224
TTTTTTTTTTGTTTTTTTTCGAGTAAGAATATGATATTATTAGTTCTATGTTTAAAAATCCAGCCTATTTGGTAAAAATCAGTGCGTCATACATGAAGGT
GAGGTCCTACCACTTCAGTAAACATCGGTGCACAAAACATGAAGGAGAGGTCCTACCACTTCTCTAGTACCAGGATTCTTGGCACCCACTACAAAATGAC
ACCCAGTTGTCCCTCAAAACTCAAGTTGCGCAAGAACTCGGTCAGGATCTCAAGCAAAAGCATTTGCAGAACCCAAGCAACTGCGGCCGCCCGAAAATTG
ATGATCACACATTCTTCCCATCTTCCCATCAAGCAGTCTTCTGTTTTGCCGCCGTGTTGGAAAGATGAGATAGGGTCCTATGGCCGACGAACACAAGGAA
CACACCGAGGAAGCTGAGGTACTTCAGAGTTGTGAAAAGATCCAGCTTAACCCAAAAGAGAACATAGAGCAACAGTACTGCTGCGATTCCGACATGGAAG
AGTGATGCGAATGCAGCAGGTCCTGGCAGGGAAGGGAAGTTCTTCAAGTTGACTCCCAGACGCATAAGCCCAATCAAGAACCCAATGAAAGGCAGGAGTA
TGAGGCCAGTAAATGCAAGCGACACTTCCTGCGGTGGCCTCTTCTCTGGCACACGGAATATGTGTTCTATCTCCTTCTGTGGCCTAAACTTTGCTAAGGG
GTCAACAGCTTGTGCCNNNNNNCGTGGGGCCTTTTCAGGGGCCTCCGGCAAGTCCAACTCCAGTTGGCCAAGGACTCGTNNNAACGAATTTTCCATTGAA
GCATCACCAACTGAAAGCTCGAGGTCATATGTT
page-top