Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32208  (registered. 2012)
Contig Information
Length 1156 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|14140122|emb|CAC39039.1|| putative plastid ribosomal protein L19 precursor [Oryza sativa]
Score 332
Evalue 5.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32208
GAAAACAAAACATAATGAAGCATATCTTGTCGAGTCGCTCGCTCGCTGGATGCTGGCCGACACTGGGCGTCGACCCGACAACACTTTTATTTAGCCCACG
CCACGCGCCACCCCGCGCAAAGCACCCCACACCTTGTACGTAGTAAAAAGCAGTAGCACTCCAGTCCACCTCTCGCTTCTTCCTCCGGCCCATGCGACGG
CATTGACATCTTTGCCCGCCTGACCTTTCGATGGCCGCCGCCGCCACCGCCGCCGCCGCAACCGGCACACTTCTTCCCCACGCACTATTGAATCACCGCT
CGCCTCCACCGCCACAGCTCCTCGCGCTTTCCTCCTCCTTCCGCCGCCTCTCCTTATCCACCTCCCATCGCCGGAACACCCATTTAGTCGCCCATGCAGA
CGCCGGTGCCGCAGAGCCGGAGCCCGCGACGGAGTCTGCTCCTGAGGGCGAGCCTGTCGCTGCCTCTGCTGACTCCGAGGAGGGGGAGGCGGAGGGGGCT
GTCGCATTGGCGGAGGAAGAGGAGGAGCCGGCGCCGAGGCCCAAGCCGATTAAGTTCGGCGAGATCATCGGGATTCTGAACAAGCAGTTCATCGAGGAGG
CTGAGAAGGTGAAAGTGCTTCCGGATTTGAAGCCCGGTGACATCATCGAGCTTAGAATGCAACGTCCCAACAAGAGGAGATTGTCTCTCTTTAAGGGTAT
AATCATTGCAAAGCACAAATCTGGTGTTCACACCACGATCCGCGTCAGGAGGATTATTGCCGGTGTTGGAGTTGAAATTACATTCCCCATATACTCACCA
AGGATCAAGGAGATCAAAGTAATCAGACACAAGAAGGTGAGGAGGGCAAAGTTGTACTACCTGAAGTACAAGCTTCCCCGTTTCTCAACCTTCAAGTGAG
ATTAGACTCGCAGCTTCTCACACTAGCATGTCGATTTCTCCTTGACAAACGAGTTTTCACAATCATGTTCAGATCTGTGCATCCACTGTAATGATCTCTG
AACCTCGAGTTGCATAATCTTACATCTTTTTTCGATTGACATATATTTCGTCTTGCGGTGGAGGAGTGTACTTGTGAGTGTATAAAATTCCTACCAGCGC
TCCGGTATGAATATGATGATGTTTATTGCGCCCTTTCCTTGCTCCCAAAAAAAAAA
page-top