Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32191  (registered. 2012)
Contig Information
Length 637 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_yd Spikelet at late flowering 10
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 5
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 6
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|55977041|sp|P68427.2|H32_PEA|H32_PEA RecName: Full=Histone H3.2
Score 263
Evalue 8.00E-69
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32191
CTCCCAGCAATCCCCCAAATCTCCTCAGCCTCCCGCGCATCTCCTCCGACATGGCCCGCACCAAGCAGACGGCGAGGAAGTCCACCGGCGGCAAGGCGCC
GAGGAAGCAGCTGGCCACCAAGGCCGCCCGCAAGTCCGCCCCGGCCACAGGCGGCGTCAAGAAGCCCCACCGCTTCCGCCCCGGCACCGTCGCCCTCCGC
GAGATCCGCAAGTACCAGAAGAGCACCGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGCCTCGTCCGCGAGATCGCCCAGGACTTCAAGACCGACCTCC
GCTTCCAGTCCTCCGCCGTCTCCGCCCTGCAGGAGGCCGCCGAGGCCTACCTGGTGGGCCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCG
CGTCACCATCATGCCCAAGGACATCCAGCTCGCCCGCCGCATCCGTGGAGAGAGGGCCTAAGCTCTGTTCGTCGTCGTCTGTTAGTCGTCCTCTTAGCCT
GATGTGTTCATCGGTGGAAATGTGCGTGCTAGTGTTTGTTCGTGTCGTGGTCGATGTAGTGTGTCTGTTCTGATGTCACCATCTTGCTGTCATCAGTAAC
TGAAATGAAAATGTTGCTATCTGTTCTAAAAAAAAAA
page-top