Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32100  (registered. 2012)
Contig Information
Length 899 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 3
Wh_CSEC Callus 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115449267|ref|NP_001048413.1|| Os02g0800100 [Oryza sativa (japonica cultivar-group)]
Score 255
Evalue 5.00E-66
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32100
ACAGCCATCAACAGCAAGGAGCCGGATCCCCTGACGTACGGCCACCTAACATTGGGCCACTGACACATGGGTCGCCGTGTCCCAACAACACAACTCAACT
ACAACGCGAAAGAGCGTACCCCAAATCGAAAATCTCGCCGCGTCTCGATGGGCGGACACCTCCGAAGAACAGCAGCAACCACCAAGCTTCCCTCGTCGAC
ACACCATCCCCCCTTAATGCCTAGAGGGGTCACCACTGATATTAGTGGGGCGCTAACGAACTTTGCTGCTAAAACACCAAACTAGCAAGAATAGTAAGTA
ACGCTCAACTAGCGACCAGGACGCCGGGGACATTTCAAGAAATTCAAACTGATGCAATACCCATTTATTTACTTCTCACGTTTCACCAATCCATGAAACT
GCCATAGATGCTGGACGGGAAGCACAAGACAAATACATGGGTGGAAGGAATCAACTGAAGCTGGGGCAGACAGGCCCCTTCGACAGGCCAAGCCGAACCT
CCATCCCGTGGTGCATGTCCGGTATGCGCAGGCTGTCAGAGTCCTGGGGCAAGTTAAGGTAATCTTCAAATCCAAAATCATCCAAGGAACCTGTCATTGC
CTCATATCCTAGCATCGATGATGGCAATGCACCTGGGGGCCTTTGGAACCTGGAGAGGATTTGTGCGTCCAGATCCTTGCGGATGTTGAAGGCGGACCCG
TAGATGGCCTCGGTCCCGAACCTCTTCTTGTCGTCCCAGAACTTGGTCTCCTTATGGATGGTGGCCTGGACGGGGTGCGGCGGCGCGAGGTCGCCCCTGA
CGCTGTCGTTGACGCCGAAGCGGAGCACGTCGTGGGTCTGCCCGATCTCCTTCTTCGTCATCGAGCTCGCCATCGTCGCTGCTCAGGCTCTCTTCTTCC
page-top